Summary

RMgm-220
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0901300; Gene model (P.falciparum): PF3D7_1147800; Gene product: membrane associated erythrocyte binding-like protein (MAEBL)
Phenotype Sporozoite; Liver stage;
Last modified: 9 June 2009, 09:54
  *RMgm-220
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 12021311
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherT. Kariu, Y Chinzei
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University School of Medicine
CityTsu
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-220
Principal namemaebl(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of oocysts are produced. The number of midgut sporozoites per mosquito was comparable to wild type. Only a few sporozoites were found to be associated with the salivary glands. Conversely, the number of hemolymph sporozoites significantly increased, indicating that they were normally released from the oocysts but accumulated in the hemolymph as a result of the lack of sporozoite entry into the salivary gland.
Midgut sporozoites showed normal gliding motility. Mutant midgut sporozoites showed an infectivity to rats comparable to wild type midgut sporozoites.
Liver stageMutant midgut sporozoites showed an infectivity to rats comparable to wild type midgut sporozoites as shown by infection rates and prepatent period in rats after intravenous injection of sporozoites.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of MAEBL.

Protein (function)
MAEBL is an 200-kD protein with a single transmembrane-like domain and is structurally related to members of the Duffy binding-like (DBL) family of homologous erythrocyte binding proteins (EBPs; EBLs - erythrocyte binding ligands) located within the micronemes of merozoites. The DBL-EBP family includes the P. vivax/P. knowlesi Duffy antigen binding proteins (DBPs) and the P. falciparum erythrocyte binding antigen 175 (EBA-175). These proteins are produced in the merozoite stage, localized in micronemes, and believed to recognize host-specific erythrocyte surface receptors and participate in a junction formation necessary for merozoite entry into the host erythrocyte. MAEBL is expressed  sporozoites and is localized in the micronemes of the sporozoite stage.

Phenotype
The phenotype analyses indicate that MAEBL is essential for sporozoite invasion of the mosquito salivary gland. The analyses indicate that MAEBL is not required for liver cell infection, which is consistent with the observation that the sporozoite greatly reduced its micronemal content of PbMAEBL after salivary gland infection. No evidence was found for expression and function of MAEBL in the merozoite stage.

Additional information
MAEBL is abundantly present in midgut (oocyst derived) sporozoites but less abundant in salivary gland sporozoites.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0901300
Gene Model P. falciparum ortholog PF3D7_1147800
Gene productmembrane associated erythrocyte binding-like protein
Gene product: Alternative nameMAEBL
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacI/KpnI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption A fragment of the 5' coding sequence was used as targeting region.
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGCGAGCTCTTATTATTTGCTTCATGTTGTATT
Additional information primer 1(SacI); 5'
Sequence Primer 2GCCGGATCCTTTATCCAAGTTCATCGAAAATGT
Additional information primer 2(BamHI); 5'
Sequence Primer 3GGCCTCGAGGATGAATATAATGAAGATTTCTTA
Additional information primer 3(XhoI); 3'
Sequence Primer 4GCCGGTACCAGATGAAAAACATCTACCATTATT
Additional information primer 4(KpnI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6