SummaryRMgm-124
|
||||||||||
*RMgm-124| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption, Gene disruption |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 18848846 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | C. Lavazec, G.R. Mair, C.J. Janse, J. Templeton |
| Name Group/Department | Department of Microbiology and Immunology |
| Name Institute | Weill Cornell Medical College |
| City | New York |
| Country | USA |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-124 |
| Principal name | ∆PbCCp1/∆PbCCp3 |
| Alternative name | 952 m1-m0cl1 |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Normal numbers of oocysts are produced. Sporozoite formation within the oocysts is blocked. Analysis of the morphology of oocysts by light microscopy revealed that the majority of 17–22 day oocysts were either vacuolated or non-sporulated, and did not contain sporozoites. |
| Sporozoite | No hemocoel and salivary gland sporozoites were detected. |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1300700 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1475500 | ||||||||||||||||||||||||
| Gene product | LCCL domain-containing protein | ||||||||||||||||||||||||
| Gene product: Alternative name | LAP2; LCCL/lectin adhesive-like protein 2; CCP1 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AATTCGGAATTACTGAATAATGAAAAGCAAATAATAATATAAATAACAAATCATAATAAT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | ClaI/SpeI double digest | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The ccp1/lap2 gene has been disrupted using a construct that contains the tgdhfr selectable marker and that integrates by double cross-over recombination. This mutant line (429cl1) has been described as mutant RMgm-121. The ccp3 (pbsr, lap1) gene has been disrupted in this line. The ccp3 gene has been disrupted using a construct that integrates by single cross-over integration (insertion vector) that contains the hdhfr selectable marker. The disadvantage of using an insertion construct is that the construct can be removed from the genome, thereby restoring the wild type genotype. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1035200 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1407000 | ||||||||||||||||||||||||
| Gene product | LCCL domain-containing protein | scavenger receptor-like protein | ||||||||||||||||||||||||
| Gene product: Alternative name | PbSR; P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; CCp3 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid single cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | WR99210 | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The construct to disrupt the ccp3 (pbsr, lap1) gene has been introduced into the genome of mutant 429cl1 (RMgm-121) that contains a disrupted ccp1/lap2 gene and the tgdhfr selectable marker. The ccp3 gene has been disrupted using a construct that integrates by single cross-over integration (insertion vector) that contains the hdhfr selectable marker. The disadvantage of using an insertion construct is that the construct can be removed from the genome, thereby restoring the wild type genotype. | ||||||||||||||||||||||||
| Additional remarks selection procedure | Because the mutant contained the tgdhfr selectable marker in its genome (used to disrupt the ccp1/lap2 locus) the ccp3 gene has been disrupted using a construct that contains the hdhfr selectable marker that provides resistance against WR99210. | ||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||