SummaryRMgm-1120
|
||||||||||
*RMgm-1120| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | ≥ 5 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25185663 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 2.34 |
| Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | Tremp AZ; Dessens JT |
| Name Group/Department | Pathogen Molecular Biology Department, Faculty of Infectious and Tropical Diseases |
| Name Institute | London School of Hygiene and Tropical Medicine |
| City | London |
| Country | UK |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1202000 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1003600 | ||||||||||||||||||||||||
| Gene product | inner membrane complex protein 1c, putative | ||||||||||||||||||||||||
| Gene product: Alternative name | IMC1c; ALV5 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The unsuccessful attempts to knock-out imc1c indicates an essential role of IMC1c in blood stage development/multiplication. The three motile and invasive stages (zoites) of Plasmodium species (i.e. ookinetes, sporozoites and merozoites), as well as zoites of other apicomplexan parasites, possess a similar cortical structure termed the pellicle. The pellicle is essentially made up of the plasma membrane and an underlying double membrane structure termed the inner membrane complex (IMC). Closely associated with the IMC on its cytoplasmic side is a network of intermediate filaments termed the subpellicular network (SPN), which supports the pellicular membranes and provides mechanical strength to the cell. Several members of an Apicomplexa-specific family of proteins termed IMC1 proteins have been identified as components of the SPN. Structurally related proteins from ciliates and dinoflagellate algae have since been added to this protein family renamed ‘alveolins’, which now defines the Alveolata infrakingdom. In the genus Plasmodium, the number of members of the alveolin family has risen to 12, which are encoded by conserved and syntenic genes. The alveolin family members display differential expression between the three zoite stages of the parasite, with the largest repertoires present in the ookinete and sporozoite according to proteomic studies. It has been shown in the rodent malaria species Plasmodium berghei that the disruption of individual alveolin family members expressed in sporozoites (PbIMC1a), in ookinetes (PbIMC1b) or in both these zoites (PbIMC1h) results in morphological abnormalities that are accompanied by reduced tensile strength of the zoite stages in which they are expressed. Besides roles in morphogenesis and mechanical strength, the Plasmodium alveolins are also involved in gliding motility in both ookinetes and sporozoites, most likely through interactions with components of the glideosome that are situated within the pellicular cytoplasm. PbIMC1c (PBANKA_120200) is composed of 278 amino acids encoded by a single exon. PbIMC1c and its orthologous. proteins share a highly conserved amino-terminal domain related to the IMCp domain superfamily (Pfam12314) that defines the IMC1 proteins/alveolins. The proteins also possess a conserved cysteine motif at the carboxyterminus similar to the cysteine motifs described in PbIMC1a and TgIMC1 that is believed to act as a palmitoylation signal. Analysis of mutants expressing fluorescent-tagged IMC1c (GFP, mCherry; RMgm-1123; RMgm-1122) showed strong expression in blood stages that appeared cytoplasmic, except in mature schizonts where it showed clear peripheral localization in individual merozoites. Ookinetes displayed very strong fluorescence with a cortical distribution. Sporulated oocysts and sporozoites also displayed strong fluorescence, which was concentrated at the cortex of the sporozoites. These combined observations are fully consistent with a pellicular localization of PbIMC1c and are in agreement with it being a predicted SPN resident. Besides the peripheral distribution of PbIMC1c in sporozoites, a thickened area was present near one extremity (anterior) of the cell. Evidence is presented for temporal recruitment to the SPN of sporozoites. The entire pbimc1c coding sequence plus ca. 0.55 kb of upstream sequence was PCR amplified from P. berghei genomic DNAwith primers pDNR-IMC1c-F (ACGAAGTTATCAGTCGACGGTACCAAGTGCATTTAGTATGTTGTGGC) and pDNR-IMC1c-R (ATGAGGGCCCCTAAGCTTCTGCATGTACCTGTACAGCAT) and cloned into SalI/HindIIIdigested pDNR-EGFP (Tremp et al., 2008) by in-fusion cloning to give plasmid pDNR-IMC1c/GFP. The 3′UTR of pbimc1c was amplified with primers pLP-IMC1c-F (ATATGCTAGAGCGGCCTTTCGTGAAAAATGCAGTTAACA) and pLP-IMC1c-R (CACCGCGGTGGCGGCCGAAAGAAGACAATAAATAAAATAGAAAGTATGG) and the resulting ca. 0.6 kb fragment cloned into NotI-digested pLPhDHFR by n-fusion cloning to give plasmid pLP-hDHFR/IMC1c. The pbimc1c/gfp-specific sequence from pDNRIMC1c/GFP was transferred to pLP-hDHFR/IMC1c by Cre/loxP recombination to give the final construct pLP-IMC1c/GFP. This plasmid served as template in a PCR-based sitedirected mutagenesis using primers IMC1c-KO-F (CAACCGTCATGAGTAAAGGAGAAGAACTTTTCAC) and IMC1c-KO-R (TTACTCATGACGGTTGATGTCTCTTTAGTGT). The resulting PCR product was circularized using in-fusion to give plasmid pLP-IMC1c-KO. In this plasmid, the pbimc1c coding sequence except for the first amino acids has been removed. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||