top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: Plasmodium |
Gene Model of Parasite |
PF3D7_1133400
|
Gene Model P. falciparum ortholog |
PF3D7_1133400
|
Gene product | apical membrane antigen 1 |
Gene product: Alternative name | AMA1 |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Circular plasmid |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The transgene ama-1 of P. falciparum (PF11_0344) is under the control of 1.5kb of the promoter region of the P. berghei homolog of ama-1 (PB000415.02.0) |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0915000
|
Gene Model P. falciparum ortholog |
PF3D7_1133400
|
Gene product | apical membrane antigen 1 |
Gene product: Alternative name | AMA1; pb66 |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | ATTCCCATGGAACCAAAATAAC |
Additional information primer 1 | fwd pb13 |
Sequence Primer 2 | TTTTATATCGTTTTATTTTATTAATATTTTTAATTTAC |
Additional information primer 2 | rev pb8 |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0719300
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Not available |
Gene Model of Parasite |
Not available
|
Gene product | Not available |
Gene product: Alternative name | |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |