Summary

RMgm-99
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1143700; Gene model (P.falciparum): PF3D7_1367800; Gene product: secreted ookinete protein, putative (PSOP2, putative secreted ookinete protein 2)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 19 February 2009, 21:04
  *RMgm-99
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-99
Principal name∆psop2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteOokinete production highly variable between and within experiments. Overall ookinete numbers tend to be reduced compared to wild type.
OocystStrongly reduced numbers of oocysts: 1% of wild type (0.4-1.3%).
SporozoiteSee also the phenotype of the oocyst. The few oocysts produced normal numbers of sporozoites that were infectious to C57BL/6 mice.
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PSOP2 (putative secreted ookinete protein)

Protein (function)
Unknown. The protein is detected in a proteome analysis of ookinetes and contains a predicted signal sequence

Phenotype
The phenotype analyzes indicate a role during invasion/traversal of the ookinetes through  the midgut wall  (controlling ookinete numbers by feeding in vitro cultivated mature ookinetes at known numbers to mosquitoes via a membrane feeding apparatus did not rescue oocyst formation).

Additional information
The few oocysts  produced normal numbers of sporozoites that were infectious to C57BL/6 mice.

A mutant has been generated with a C-terminal c-myc tag of PSOP2 (RMgm-111). IFA-analysis using c-myc antibodies showed an apical location in the ookinetes.
The tagged protein PSOP2-myc migrates significantly faster in SDS-PAGE than its predicted molecular weight  and thus may undergo proteolytic processing. The mutant expressing tagged PSOP2 shows normal mosquito infectivity, indicating that the myc-tagged protein is functional. 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1143700
Gene Model P. falciparum ortholog PF3D7_1367800
Gene productsecreted ookinete protein, putative
Gene product: Alternative namePSOP2, putative secreted ookinete protein 2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCTAATTGATTCTGAACATGTCAGG
Additional information primer 1AE02a (ApaI); 5'
Sequence Primer 2CCAAGCTTGAAAAAACCAAAAGTTAAAGCAC
Additional information primer 2AE02b (HindIII); 5'
Sequence Primer 3TGAATTCTATATGTATGCGTTCACATATTG
Additional information primer 3AE02c (EcoRI); 3'
Sequence Primer 4GGGGATCCAGCATGTTGACATGTATATTATG
Additional information primer 4AE02d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6