RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-982
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0501200; Gene model (P.falciparum): PF3D7_1016900; Gene product: early transcribed membrane protein 10.3 | protein of early gametocyte 4 (UIS4; ETRAMP10.3)
Name tag: mCherry
Transgene
Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Liver stage;
Last modified: 16 September 2015, 18:37
  *RMgm-982
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24423236
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherGrutzke, J; Matuschewski K; Ingmundson A.
Name Group/DepartmentMax Planck Institute for Infection Biology
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-982
Principal nameUIS4-mCherry
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stagemCherry expression in liver stages. Consistent with the published localization of UIS4 UIS4-mCherry localizes to the parasitophorous vacuole membrane (PVM) and to the associated tubovesicular network (TVN) of the developing pre-erythrocytic parasites (see also 'Additional remarks phenotype'.
Additional remarks phenotype

Mutant/mutation
The mutant expresses an C-terminal mCherry-tagged version of UIS4 and expresses GFP under the control of the constitutive eef1a promoter 

Phenotype
UIS4 expression in liver stages and GFP expression in all life cycle stages. This parasite shows normal development throughout the complete life cycle indicating that the tagging does not affect viability of parasites.

mCherry expression in liver stages. Consistent with the published localization of UIS4 UIS4-mCherry localizes to the parasitophorous vacuole membrane (PVM) and to the associated tubovesicular network (TVN) of the developing pre-erythrocytic parasites (see also below).

Additional information
In cells infected with the UIS4-mCherry parasites several dynamic UIS4-mCherry-positive features extending from the PVM into the host cell were observed by live cell microscopy.  These were dynamic vesicles, elongated clusters of membranes and long tubules that rapidly extend and contract from the PVM in a microtubule-dependent manner Labeling of host cell compartments revealed association of late endosomes and lysosomes with the elongated membrane clusters. These observations indicate
that the membranes surrounding intra-hepatic Plasmodium are involved in active remodeling of host cells.

Other mutants
RMgm-983: A mutant expressing a C-terminal mCherry-tagged version of UIS4 under the control of the UIS4 promoter. This reporter cassette is integrated into the (silent) locus of the C-type ssu rRNA gene


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0501200
Gene Model P. falciparum ortholog PF3D7_1016900
Gene productearly transcribed membrane protein 10.3 | protein of early gametocyte 4
Gene product: Alternative nameUIS4; ETRAMP10.3
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor the construction of the plasmid UIS4-mCherry, a portion of the UIS4 5’UTR (645 bp) and the coding region of UIS4 was PCR-amplified using primers UIS4SacIIfor (TCCCCGCGGGGACCACGAAATATGCCATAAATAGAC) and UIS4SpeIrev (CGGACTAGTCCGTATGTATGGGCCGAATG) and cloned into the SacII and SpeI sites of the vector B3D+mCherry.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration.
Additional remarks selection procedureThe reporter parent line expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15'-cccaagcttccgcgggtatatggtaaagaacctactaacac
Additional information primer 1primer L1345: 0.7kb 5'region of PBANKA_030600 (230p gene)
Sequence Primer 25'-cccaagcttgatgtgttttatttggatgtgc
Additional information primer 2primer L1346: 0.7kb 5'region of PBANKA_030600 (230p gene)
Sequence Primer 35'-ccggaattctcttgagcccgttaatg
Additional information primer 3primer L1347: 1kb 3'region of PBANKA_030600 (230p gene)
Sequence Primer 45'-tccccgcgggtatggaactacatctatatagg
Additional information primer 4primer L1348: 1kb 3'region of PBANKA_030600 (230p gene)