Summary

RMgm-969
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1109400; Gene model (P.falciparum): PF3D7_0509800; Gene product: phosphatidylinositol 4-kinase (PI4K; PI(4)K)
Details mutation: PbPI(4)K(His1477Tyr) (equivalent to His1484Tyr in PfPI(4)K)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Liver stage;
Last modified: 14 December 2013, 21:47
  *RMgm-969
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24284631
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 676m1cl1 (RMgm-29)
Other information parent line676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherC.W. McNamara; D.A. Fidock; E.A. Winzeler
Name Group/DepartmentGenomics Institute of the Novartis Research Foundation
Name InstituteGenomics Institute of the Novartis Research Foundation
CitySan Diego, California 92121
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-969
Principal name-
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageLiver stages showed increased resistance against PI4k inhbitors.
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of PI4K. This mutation (His1477Tyr) is equivalent to His1484Tyr in P. falciparum clones that are resistant against inhibitors of PI4K.

Protein (function)
Parasite PI(4)K type III beta (PI(4)KIIIb) is a ubiquitous eukaryotic enzyme that phosphorylates lipids to regulate intracellular signalling and trafficking.
Pfpi4k (PF3D7_0509800; PI(4)KIIIb) is one of two annotated PI(4)Ks. Type IIIb phosphatidylinositide kinases are conserved among eukaryotes and function to convert phosphatidylinositol to PI(4)P. Within the cell, PI(4)P regulates effector protein recruitment and lipid-sorting events at the Golgi, and is a precursor for the generation of phosphatidylinositol- 4,5-bisphosphate at the plasma membrane.

Evidence is presented that inhibition of PI4K affects merozoite formation (interfering with membrane biogenesis around the developing merozoite). It is proposed that Plasmodium PI(4)K acts at the Golgi to locally generate PI(4)P, which in turn recruits effectors that generate transport vesicles destined for the ingressing plasma membrane.

Sequencing of pfpi4k in two P. falciparum clones that are resistant against PI4K inhibitors revealed an identical nonsynonymous SNV that led to a His1484Tyr coding change.

Phenotype
The mutant expresses a mutated form of PI4K. This mutation (His1477Tyr) is equivalent to His1484Tyr in P. falciparum clones that are resistant against inhibitors of PI4K. No information is provided on blood or mosquito stages. Liver stages showed increased resistance against PI4k inhbitors.

Additional information

Other mutants


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1109400
Gene Model P. falciparum ortholog PF3D7_0509800
Gene productphosphatidylinositol 4-kinase
Gene product: Alternative namePI4K; PI(4)K
Details of the genetic modification
Short description of the mutationPbPI(4)K(His1477Tyr) (equivalent to His1484Tyr in PfPI(4)K)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAn 1,857-bp fragment of PbPI(4)K (PBANKA_110940) was PCR-amplified using primer pair p1/p2 (p1: ACAGGTACCATAAGAATGAAATGGGAAGAAGGAG; p2: ACAGGGCCCTTACATAATTCCATTTGTTATTCGTTG) and cloned into a Topo TA vector (Invitrogen). Subsequently, site-directed mutagenesis (Stratagene) was performed with primers p3/p4 (p3: GAAGCTCGCAAATATTCTGAAGAAATTATTC; p4: CTTCGAGCGTTTATAAGACTTCTTTAATAAG) to introduce the non-synonymous coding mutation C4519T (encodes Tyr 1477; mutation located 556 bp upstream of the stop codon). The KpnI/PspM01-digested fragment was cloned into pl0001-TgDHFR-KO (obtained from MR4, MRA-770), in which the pycrt 3′ untranslated region (UTR) (terminating sequence; primers p12/p13) and PbPI(4)K 3′ UTR (second homology site; primers p10/p11) were also included.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4