RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-939
Malaria parasiteP. chabaudi
Genotype
Transgene
Transgene not Plasmodium: mCherry
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: Not available; Gene product: Not available (small subunit (ssu) ribosomal RNA locus)
Phenotype Asexual bloodstage;
Last modified: 14 September 2013, 22:11
  *RMgm-939
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21455190
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. chabaudi
Parent strain/lineP. c.chabaudi AS
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherSpence PJ.; Langhorne J; Thompson J.
Name Group/DepartmentDivision of Parasitology
Name InstituteMRC National Institute for Medical Research
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-939
Principal namemCherryPcc AS
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stagemCherry expression in blood stages
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant contains the mCherry gene under control of the P. berghei elongation factor 1 alpha (eef1a) promoter integrated into the small subunit (ssu) ribosomal RNA locus

Protein (function)

Phenotype
mCherry expression in blood stages

Additional information
To generate a vector that introduces mCherry into the P.c. chabaudi SSu-rRNA locus on chromosomes 5, the Pl0017 plasmid vector (Franke-Fayard, B. et al. 2004; Mol. Biochem. Parasitol. 137, 23–33)  was modified as follows: (i) A KpnI-ApaI fragment of the P. berghei SSu-rRNA target region of pL0017 was excised and replaced with the corresponding 704-bp region of P.c. chabaudi chromosome 5 SSu-rRNA that was amplified from Pcc AS genomic DNA using the primers; GACTGGTACCAGTAGTCATATGCTTGTCTC and CAATGGGCCCTATAGTTAAAAGTACGACGAGGC (restriction sites underlined); (ii) The BamH1-Not1 fragment of PF0017 encoding green fluorescent protein was excised and replaced with mCherry.

Other mutants


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene namemCherry
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo generate a vector that introduces mCherry into the P.c. chabaudi SSu-rRNA locus on chromosomes 5, the Pl0017 plasmid vector (Franke-Fayard, B. et al. 2004; Mol. Biochem. Parasitol. 137, 23–33) was modified as follows: (i) A KpnI-ApaI fragment of the P. berghei SSu-rRNA target region of pL0017 was excised and replaced with the corresponding 704-bp region of P.c. chabaudi chromosome 5 SSu-rRNA that was amplified from Pcc AS genomic DNA using the primers; GACTGGTACCAGTAGTCATATGCTTGTCTC and CAATGGGCCCTATAGTTAAAAGTACGACGAGGC (restriction sites underlined); (ii) The BamH1-Not1 fragment of PF0017 encoding green fluorescent protein was excised and replaced with mCherry.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative namesmall subunit (ssu) ribosomal RNA locus
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4