RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-89
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1113400; Gene model (P.falciparum): PF3D7_0513700; Gene product: secreted ookinete protein, putative | 6-cysteine protein (PSOP12, putative secreted ookinete protein 12)
PhenotypeNo phenotype has been described
Last modified: 6 May 2009, 17:28
  *RMgm-89
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
top of page
Name of the mutant parasite
RMgm numberRMgm-89
Principal nameΔpsop12
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PSOP12 (putative secreted ookinete protein).

Protein (function)
Unknown. The protein is detected in a proteome analysis of ookinetes and contains a predicted signal sequence.

Phenotype
The lack of expression of PSOP12 does not result in a clear phenotype. In this study no in depht analysis of the phenotype of the different life cycle stages has been performed. Numbers of salivary gland sporozoites in Anopheles stephensi are normal. Oocyst production is variable and lower compared to wild type (but not significantly different). The mutant could 'easily be transmitted' by A. stephensi.

Additional information
Two gene models exist: PB000504.03.0 and PB000499.03.0

Other mutants
RMgm-254: An independent mutant lacking expression of PSOP12

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1113400
Gene Model P. falciparum ortholog PF3D7_0513700
Gene productsecreted ookinete protein, putative | 6-cysteine protein
Gene product: Alternative namePSOP12, putative secreted ookinete protein 12
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTwo partial gene models exist: PB000504.03.0 and PB000499.03.0
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCGTCATTATCAGCTTGTAAATAGG
Additional information primer 1AE12a (ApaI); 5'
Sequence Primer 2TAAAAGCTTTCAATTTATGTGTC
Additional information primer 2AE12b (HindIII); 5'
Sequence Primer 3TGAATTCGTTTCTTATTGCACACACATACA
Additional information primer 3AE12c (EcoRI); 3'
Sequence Primer 4GGGGATCCATCCGCTAAAGATGCATTGAATG
Additional information primer 4AE12d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren