RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-82
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0204800; Gene model (P.falciparum): PF3D7_0108700; Gene product: secreted ookinete protein, putative (PSOP24, putative secreted ookinete protein 24)
PhenotypeNo phenotype has been described
Last modified: 19 February 2009, 20:52
  *RMgm-82
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0204800
Gene Model P. falciparum ortholog PF3D7_0108700
Gene productsecreted ookinete protein, putative
Gene product: Alternative namePSOP24, putative secreted ookinete protein 24
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption gene disruption (fragments encoding N- term. 116 and C-term. 456(Pf) amino acids retained)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCCAAGGGGGAAAAGTTGAAAATTG
Additional information primer 1AE24a (KpnI); 5'
Sequence Primer 2TTGGGCCCCTTTTCCGCTCTCATTCCTTATG
Additional information primer 2AE24b (HindIII); 5'
Sequence Primer 3TGAATTCACAGCATATTTTAGAAAATACTG
Additional information primer 3AE24c (EcoRI);3'
Sequence Primer 4GGGGATCCTTAATATAATTTTCATCATATTC
Additional information primer 4AE24d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6