RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-746
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0510600; Gene model (P.falciparum): PF3D7_1026400; Gene product: cell division cycle protein 20 homolog, putative (CDC20; CDH1)
Phenotype Gametocyte/Gamete; Fertilization and ookinete;
Last modified: 19 May 2012, 19:36
  *RMgm-746
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22383885
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherD.S. Guttery; R. Tewari
Name Group/DepartmentCentre for Genetics and Genomics, School of Biology Queens Medical Centre
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-746
Principal nameΔcdc20
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNormal numbers of gametocytes are formed. Male gametocytes fail to form gametes (exflagellate). Female gametocytes produce fertile female gametes (as shown by cross-fertilisation with wild-type male gametes).
Fertilization and ookineteNo zygotes and ookinetes are formed. Normal numbers of gametocytes are formed. Male gametocytes fail to form gametes (exflagellate). Female gametocytes produce fertile female gametes (as shown by cross-fertilisation with wild-type male gametes).
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of cell division cycle protein 20 homolog, putative (CDC20/CDH1).

Protein (function)
During eukaryotic mitosis anaphase and mitotic exit is regulated by the conserved multi-subunit E3 ubiquitin ligase Anaphase Promoting Complex/Cyclosome (APC/C), which targets mitotic regulators such as securin and cyclin B for destruction by the 26S proteosome. Two of the major regulators of APC/C activity are cell-division cycle protein 20 (CDC20) (also known as Fizzy, p55CDC or Slp1) and its homologue, CDC20 homologue 1 (CDH1 – also known as Cdh1p/Hct1p, Fizzy-related, Ste9, Srw1 or Ccs52). CDC20 and CDH1 are related tryptophan-aspartic acid (WD)-40 repeat- containing adaptor proteins, which are highly conserved throughout eukaryotic evolution. CDC20 protein accumulates during S-phase, peaks in mitosis and activates the phosphorylated APC/C complex (which is phosphorylated by cyclin-dependent kinase 1 (CDK1) and other mitotic kinases by physical association, which results in the activation of the metaphase-anaphase transition and degradation of mitotic cyclins via ubiquitination.
Sequence analyses of P. berghei identified a cdc20 gene (PBANKA_051060) comprised of one exon. The protein contains a classical KEN-box, RVL-cyclin binding motif, IR motif and seven WD-40 repeat motifs as found in CDC20 and CDH1 of other organisms, but does not contain a C-box, D-box or a Mad2-interacting motif. Only a single CDC20/CDH1 homologue was identified in diferent Plasmodium species.

Phenotype
Normal numbers of gametocytes are formed. Male gametocytes fail to form gametes (exflagellate). Female gametocytes produce fertile female gametes (as shown by cross-fertilisation with wild-type male gametes). Evidence is presented that genome replication in the activated male gametocytes (for formation of the 8 haploid male gametes) and formation of axonemes is not affected. Ultrastructural analyses provided evidence for a lack of  chromosome condensation and 'aborted' nuclear spindle kinetochore formation.

Additional information
Analyses of mutants expressing C-terminally GFP-tagged CDC20 provided evidence for expression of CDC20 in nuclei of all blood stages (asexual and sexual) with upregulation in nuclei of male gametocytes.

Other mutants
RMgm-744: a mutant in which the endogenous cdc20 is C-terminally tagged with GFP
RMgm-745: a mutant expressing  GFP-tagged CDC20 episomally (using the same plasmid utilized to target the endogenous locus described in RMgm-744) under control of the cdc20 promoter


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0510600
Gene Model P. falciparum ortholog PF3D7_1026400
Gene productcell division cycle protein 20 homolog, putative
Gene product: Alternative nameCDC20; CDH1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI, XbaI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe targeting vector for cdc20 was constructed using the pBSDHFRcassette, in which polylinker sites flank a Toxoplasma gondii dhfr/ts expression cassette conveying resistance to pyrimethamine. PCR primers N10-1 (5’-CCCCGGGCCCGAGCTGTCTACTGCTCTGGTAAAGCC-3’) and N10-2 (5’-GGGGAAGCTTCATTATTCTGGATCATAGCTCTC-3’) were used to generate a 452 base pair (bp) fragment 5’ upstream sequence of Pbcdc20 from genomic DNA, which was inserted into ApaI and HindIII restriction sites upstream of the dhfr/ts cassette of pBS-DHFR. A 579 bp fragment generated with primers N10-3 (5’-CCCCGAATTCGGAACTTCTCTTGTTTCTGGATCTCC-3’) and N10-4 (5’-GGGGTCTAGAGCATGCTAATTAGCTTCACATCCG-3') from the 3' flanking region of Pbcdc20 was then inserted downstream of the dhfr/ts cassette using EcoRI and XbaI restriction sites. The linear targeting sequence was released using ApaI/XbaI.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGGCCCGAGCTGTCTACTGCTCTGGTAAAGCC
Additional information primer 1N10-1
Sequence Primer 2GGGGAAGCTTCATTATTCTGGATCATAGCTCTC
Additional information primer 2N10-2
Sequence Primer 3CCCCGAATTCGGAACTTCTCTTGTTTCTGGATCTCC
Additional information primer 3N10-3
Sequence Primer 4GGGGTCTAGAGCATGCTAATTAGCTTCACATCCG
Additional information primer 4N10-4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6