RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-668
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1312700; Gene model (P.falciparum): PF3D7_1449000; Gene product: gamete egress and sporozoite traversal protein, putative (GEST, gamete egress and sporozoite traversal protein)
Name tag: GFP
Phenotype Gametocyte/Gamete; Sporozoite;
Last modified: 6 December 2011, 15:02
  *RMgm-668
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21958024
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherTalman A.M.; Sinden R.E.
Name Group/DepartmentDepartment of Life Sciences
Name InstituteImperial College
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-668
Principal nameGEST-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteExpression of GEST-GFP in male and female gametocytes with higher expression in females. GEST-GFP signals re-distribute upon activation of gametocytes (see 'Additional remarks phenotype').
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteExpression of GEST-GFP in sporozoites (see 'Additional remarks phenotype').
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged form of GEST (gamete egress and sporozoite traversal protein).

Phenotype
Phenotype analyses indicate expression of GEST in male and female gametes. Evidence is presented for a location of GEST in osmiophilic bodies (OB) of male and female gametocytes. In addition GEST is expressed in sporozoites and evidence is presented for secretion of GEST by sporozoites.

Phenotype analyses of a mutant lacking expression of GEST (see mutant RMgm-667) indicates a role of GEST in the egress of male and female gametes from the erythrocyte. In addition, these analyses indicate that GEST plays a role in cell traversal/wounding of sporozoites.

Additional information
Evidence is presented for a location of GEST in osmiophilic bodies (OB) of male and female gametocytes. In addition evidence was found for secretion of GEST from OBs upon activation of gametocytes. GEST-GFP signals showed overlap with the distribution of another OB protein, MDV-1/PEG3

In sporozoites the GEST-GFP signals showed overlap with the distribution of a micronemal protein AMA-1. GEST-GFP signals were also observed in the trails left by motile sporozoites, indicating secretion of GEST by sporozoites.

Other mutants
RMgm-667: A mutant lacking expression of GEST


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1312700
Gene Model P. falciparum ortholog PF3D7_1449000
Gene productgamete egress and sporozoite traversal protein, putative
Gene product: Alternative nameGEST, gamete egress and sporozoite traversal protein
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodiesRabbit anti-GFP (ABCAM, USA)
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, KpnI, HpaI
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe GEST-GFP plasmid was generated by amplifying a 1 kb region of the most 3′ edge of the coding sequence of GEST with primers 10 and 14 and inserted into pOB150. The GEST coding sequence was thus fused to GFP, the plasmid also contained the human dhfr resistance marker.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AATAGGGCCCTTGTTGTATTATTTTTTTCTCTTCCTTTTCTATTTG
Additional information primer 110 (ApaI)
Sequence Primer 2AATAGGTACCATGAAAGTCTTTTTGTGTTATGCTAGC
Additional information primer 214(KpnI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6