Back to search resultsSummaryRMgm-638
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging, Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 21801293 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | Not applicable |
Other information parent line | |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | R.R. Stanway; V.T. Heussler |
Name Group/Department | Bernhard Nocht Institute for Tropical Medicine |
Name Institute | Bernhard Nocht Institute for Tropical Medicine |
City | Hamburg |
Country | Germany |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-638 |
Principal name | PbLSmCherryNUCLEO CGFPAPICO |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not tested |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | Not tested |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | The mutant has been used to visualize the apicoplast and mitochondrion during liver stage development. |
Additional remarks phenotype | Mutant/mutation |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1420600 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0714000 | ||||||||||||||||||||||||||
Gene product | histone H2B variant | ||||||||||||||||||||||||||
Gene product: Alternative name | H2Bv | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | mCherry | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | mCherry targeted to the nucleus by fusion to the targeting sequence of the histone H2B variant protein (H2Bv). Expression under control of the liver stage-specific sequestrin promoter (PBANKA_100300). | ||||||||||||||||||||||||||
Commercial source of tag-antibodies | |||||||||||||||||||||||||||
Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | For targeting mCherry to nuclei, the full-length P. berghei histone 2Bv (PBANKA_142060) coding sequence was excised from the plasmid pLSH2Bv-GFP (Nagel et al., submitted; referred to here as pLSGFPNUCLEO) and ligated into the plasmid pLSmCherry, generating the plasmid pLSmCherryNUCLEO. To create the plasmid for double-fluorescent parasite generation, the expression cassette for constitutive GFP expression, targeted to the apicoplast was amplified by PCR from the plasmid pGFPAPICO (Stanway et al., referred to here as pCGFPAPICO) using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1aa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG,binding to the 3’ of the 3’UTR of the pbdhfr/ts.This cassette was ligated into the plasmid pLSmCherryNUCLEO to generate the plasmid pLSmCherryNUCLEO CGFPAPICO. The plasmid allows integration into the c- and dssu-rrna locus by single crossover | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0305600 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0208500 | ||||||||||||||||||||||||||
Gene product | acyl carrier protein | ||||||||||||||||||||||||||
Gene product: Alternative name | ACP | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | GFP | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | GFP targeted to the apicoplast by fusion to the targeting sequence of the acyl carrier protein (ACP). Expression under control of the constitutive eef1αa promoter (PBANKA_113330). | ||||||||||||||||||||||||||
Commercial source of tag-antibodies | |||||||||||||||||||||||||||
Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | For targeting mCherry to nuclei, the full-length P. berghei histone 2Bv (PBANKA_142060) coding sequence was excised from the plasmid pLSH2Bv-GFP (Nagel et al., submitted; referred to here as pLSGFPNUCLEO) and ligated into the plasmid pLSmCherry, generating the plasmid pLSmCherryNUCLEO. To create the plasmid for double-fluorescent parasite generation, the expression cassette for constitutive GFP expression, targeted to the apicoplast was amplified by PCR from the plasmid pGFPAPICO (Stanway et al., referred to here as pCGFPAPICO) using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1aa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG,binding to the 3’ of the 3’UTR of the pbdhfr/ts.This cassette was ligated into the plasmid pLSmCherryNUCLEO to generate the plasmid pLSmCherryNUCLEO CGFPAPICO. The plasmid allows integration into the c- and dssu-rrna locus by single crossover | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |