Summary

RMgm-614
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0403200; Gene model (P.falciparum): PF3D7_0304600; Gene product: circumsporozoite (CS) protein (CSP)
Details mutation: Mutated pexel/VTS motif and the H-2K(d) epitope SYIPSAEKI mutated to the H-2K (b)epitope SIINFEKL
Phenotype Sporozoite; Liver stage;
Last modified: 25 April 2011, 11:35
  *RMgm-614
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21445239
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherI.A. Cockburn; F. Zavala
Name Group/DepartmentJohns Hopkins Malaria Research Institute and Department of Molecular Microbiology and Immunology
Name InstituteJohns Hopkins Bloomberg School of Public Health, Johns Hopkins University
CityBaltimore
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-614
Principal nameCS5M ΔP1–2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteSee additional remarks phenotype.
Liver stageSee additional remarks phenotype.
Additional remarks phenotype

Mutant/mutation
In the mutant (CS5MΔP1-2) the wild type cs gene is replaced with a mutated cs gene carrying 5 mutations that changed the natural H-2Kd restricted epitope SYIPSAEKI to SIINFEKL, an H-2Kb restricted epitope. In addition, the Pexel/VTS motifs of the cs gene are mutated (he conserved arginine and leucine were mutated to alanine; see also mutant RMgm-286 for a P. berghei mutant expressing a cs gene with  similar mutated Pexel/vTS motifs).

Protein (function)
The CS protein is the major protein on the surface of sporozoites and is critical for development of sporozoites within the oocysts and is involved in motility and invasion of both the salivary gland of the mosquito and the liver cells. The protein is also found on the oocyst plasma membrane and on the inner surface of the oocyst capsule. Specific motifs in CS are involved in sporozoite binding to mosquito salivary glands and in sporozoite attachment to heparan sulfate proteoglycans in the liver of the mammalian host. During substrate-dependent locomotion of sporozoites, CS is secreted at the sporozoite anterior pole, translocated along the sporozoite axis and released on the substrate at the sporozoite posterior pole. Following sporozoite invasion of hepatocytes, the CS is released in the host cell cytoplasm.

Phenotype
See additional information.

Additional information
Two mutants have been analysed in this study:
1) The CS5M mutant (RMgm-613) in which  the wild type cs gene is replaced with a mutated cs gene carrying 5 mutations that changed the natural H-2Kd restricted epitope SYIPSAEKI to SIINFEKL, an H-2Kb restricted epitope;
2) The CS5MΔP1-2 which, in addition to the mutated cs gene with the SIINFEKL H-2Kb epitope, contains mutations in the Pexel/VTS motifs of the cs gene.

Phenotype analyses of both mutants revealed the following:
Phenotype analyses of sporozoites of these mutants provide evidence that both dendritic cells (DCs) and hepatocytes CS epitopes must reach the cytosol and use the TAP transporters to access the ER.
In addition evidence is presented that in DCs, CS is cross-presented via endosomes while, conversely, in hepatocytes the CS protein must be secreted directly into the cytosol. These observations suggests that the main targets of protective CD8+ T cells are parasite proteins exported to the hepatocyte cytosol.
Secretion of the CS protein into hepatocytes was not dependent upon parasite-export (Pexel/VTS) motifs in this protein (see also mutant
Phenotype analyses of another mutant with similarly mutated Pexel/VTS motifs had indicated CS export to the hepatocyte cytosol was eliminated in the absence of  functional Pexel/VTS motifs (see mutant RMgm-286). Sporozoites of both mutants that express CS with mutated Pexel/VTS motifs show reduced infectivity.

Other mutants
RMgm-613: A mutant (CS5M) in which the wild type cs gene is replaced with a mutated cs gene carrying 5 mutations that changed the natural H-2Kd restricted epitope SYIPSAEKI to SIINFEKL, an H-2Kb restricted epitope
RMgm-286: A mutant expressing CS with mutated Pexel/VTS motifs (the conserved arginine and leucine mutated to alanine by site directed mutagenesis).


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0403200
Gene Model P. falciparum ortholog PF3D7_0304600
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCSP
Details of the genetic modification
Short description of the mutationMutated pexel/VTS motif and the H-2K(d) epitope SYIPSAEKI mutated to the H-2K (b)epitope SIINFEKL
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, SacI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationP. berghei CS5MDP1–2 parasites were generated similarly to the CS5M mutant (RMgm-613). Arg32 and Leu34 in the CS gene on the pIC-CS5M plasmid were mutated to Alanines by using the QuikChange site directed mutagenesis kit with the primers PEXEL1 F and PEXEL1 R which include a Bsm1 site. Arg66 and Leu68 were mutated similarly with the primers PEXEL2 F and PEXEL2 R that include an ApaB1 site.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCATCCAAGCCCAAGCGAATGCAAACGAGCTATGTTACAATGAAGG
Additional information primer 1PEXEL1 F
Sequence Primer 2CCTTCATTGTAACATAGCTCGTTTGCATTCGCTTGGGCTTGGATGC
Additional information primer 2PEXEL1 R
Sequence Primer 3CAATCGAAATACAGTCAACGCATTAGCTGCCGATGCTCCCGAAGG
Additional information primer 3PEXEL2 F
Sequence Primer 4CCTTCGGGAGCATCGGCAGCTAATGCGTTGACTGTATTTCGATTG
Additional information primer 4PEXEL2 R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6