Summary

RMgm-613
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0403200; Gene model (P.falciparum): PF3D7_0304600; Gene product: circumsporozoite (CS) protein (CSP)
Details mutation: the natural H-2K(d) restricted epitope SYIPSAEKI mutated to SIINFEKL, an H-2K(b) restricted epitope
Phenotype Sporozoite; Liver stage;
Last modified: 26 April 2011, 17:22
  *RMgm-613
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21445239
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherI.A. Cockburn; F. Zavala
Name Group/DepartmentJohns Hopkins Malaria Research Institute and Department of Molecular Microbiology and Immunology
Name InstituteJohns Hopkins Bloomberg School of Public Health, Johns Hopkins University
CityBaltimore
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-613
Principal nameCS5M
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteThe mutant produces normal numbers of salivary gland sporozoites. See also additional remarks phenotype.
Liver stageThe mutant produces normal numbers of salivary gland sporozoites. Salivary gland sporozoites show normal infectivity to mice. See also additional remarks phenotype.
Additional remarks phenotype

Mutant/mutation
In the mutant (CS5M) the wild type cs gene is replaced with a mutated cs gene carrying 5 mutations that changed the natural H-2Kd restricted epitope SYIPSAEKI to SIINFEKL, an H-2Kb restricted epitope

Protein (function)
The CS protein is the major protein on the surface of sporozoites and is critical for development of sporozoites within the oocysts and is involved in motility and invasion of both the salivary gland of the mosquito and the liver cells. The protein is also found on the oocyst plasma membrane and on the inner surface of the oocyst capsule. Specific motifs in CS are involved in sporozoite binding to mosquito salivary glands and in sporozoite attachment to heparan sulfate proteoglycans in the liver of the mammalian host. During substrate-dependent locomotion of sporozoites, CS is secreted at the sporozoite anterior pole, translocated along the sporozoite axis and released on the substrate at the sporozoite posterior pole. Following sporozoite invasion of hepatocytes, the CS is released in the host cell cytoplasm.

Phenotype
See additional information below

Additional information
Phenotype analyses of sporozoites of the mutant (CS5M), expressing a mutated CS protein with the H-2Kb epitope SIINFEKL, provide evidence that both dendritic cells (DCs) and hepatocytes CS epitopes must reach the cytosol and use the TAP transporters to access the ER.
In addition evidence is presented that in DCs, CS is cross-presented via endosomes while, conversely, in hepatocytes the CS protein must be secreted directly into the cytosol. These observations suggests that the main targets of protective CD8+ T cells are parasite proteins exported to the hepatocyte cytosol.
Secretion of the CS protein into hepatocytes was not dependent upon parasite-export (Pexel/VTS) motifs in this protein (see also mutant RMgm-614).

In the CS5M mutant the epitope SIINFEKL is inserted in place of a well-defined natural epitope, leaving intact the neighboring residues to ensure correct proteasomal processing, thus the model epitope is presented exactly as the natural CS epitope. This makes this mutant an useful system in which to study antigen processing and presentation. Therefore, the authors anticipate that the CS5M mutant will be a powerful tool for use in future studies of antigen specific immune responses to malaria sporozoites.

Other mutants
RMgm-614: A mutant expressing a mutated CS containing the model SIINFEKL H-2Kb restricted epitope with additional mutations of the Pexel/VTS motifs


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0403200
Gene Model P. falciparum ortholog PF3D7_0304600
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCSP
Details of the genetic modification
Short description of the mutationthe natural H-2K(d) restricted epitope SYIPSAEKI mutated to SIINFEKL, an H-2K(b) restricted epitope
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, SacI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationA SexA1 site was introduced by mutation of G to A at position 714 in the CS gene (silent in Gln238) and a BsmF1 site was introduced by a mutation of T to C at position 810 (silent in Asp270) using the QuikChange XL site directed mutagenesis kit (Stratagene). The SexA1-BsmF1 fragment was excised and replaced with a ,100 bp insert including the SIINFEKL epitope in place of the SYIPSAEKI sequence (formed from the oligos S8ins F and S8insR)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCAGGTGGTAATAACAATAACAAAAATAATAATAATGACGATTCTATCATCAATTTCGAAAAACTACTAGAATTTGTTAAACAGATCAGGGACAGTATCA
CAG
Additional information primer 1S8 insert F
Sequence Primer 2TCCTCTGTGATACTGTCCCTGATCTGTTTAACAAATTCTAGTAGTTTTTCGAAATT-GATGATAGAATCGTCATTATTATTATTTTTGTTATTGTTATTA
CCA
Additional information primer 2S8 insert R
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6