Summary

RMgm-610
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1219500; Gene model (P.falciparum): PF3D7_0709000; Gene product: chloroquine resistance transporter (CRT)
Details mutation: crt of P. berghei replaced by the (chlorquine-sensitive, HB3) P. falciparum crt gene (MAL7P1.27)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Oocyst;
Last modified: 1 June 2011, 10:07
  *RMgm-610
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21288823
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; V. Lakshmanan, D.A. Fidock
Name Group/DepartmentDepartment of Microbiology and Immunology
Name InstituteColumbia University Medical Center
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-610
Principal namePbHB3
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageSee additional remarks phenotype
Gametocyte/GameteSee additional remarks phenotype
Fertilization and ookineteNot tested
OocystSee additional remarks phenotype
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
Mutant in which the  crt gene of P. berghei is replaced by the P. falciparum crt  gene (MAL7P1.27) of the chloroquine (CQ) sensitive HB3-strain (with a C-terminal V5 epitope tag)

Protein (function)
The Chloroquine Resistance Transporter (CRT) is an integral membrane protein localized to the parasite's internal digestive vacuole membrane. Mutations in CRT result in a decreased accumulation of chloroquine within the digestive vacuole in the parasite as a result of increased transport of chloroquine.

Phenotype
The phenotype analyses of mutant PbHB3 indicate that CRT of P. falciparum can complement the function of CRT of P. berghei. A conserved function of CRT in different Plasmodium species is also supported by the high degree of sequence identity (~64%) between pfcrt and its orthologs in rodent Plasmodium species. 
Asexual blood stages of mutant PbHB3 and wild type P. berghei showed the same (in vitro and in vivo) sensitivity to chloroquine and amodiaquine.
Evidence is presented that in the presence of chloroquine, the mutant PbHB3 is at a selective disadvantage during mosquito transmission compared to mutant  RMgm-611 (Pb7G8) in which  the crt gene of P. berghei is replaced by the P. falciparum crt gene of the chloroquine (CQ) resistant 7G8-strain. (Limited) evidence (based on morphology of gametocytes) is presented that in the presence of chloroquine gametocytes of  PbHB3 and wild type P. berghei are affected (pigment clumping) whereas gametocytes of mutant Pb7G8 showed wild type morphology in the presence of chloroquine.   

Additional information
The crt gene of the CQ resistant P. falciparum strain 7G8 carries 5 point mutations, resulting in amino acid changes C72S, K76T, A220S, N326D, and I356L. This SVMNT (codon 72–76)-type haplotype is common in South America and Papua New Guinea and is occasionally observed in Southeast Asia and India.
See mutant RMgm-611 (Pb7G8) in which  the crt gene of P. berghei is replaced by the P. falciparum crt gene of the chloroquine (CQ) resistant 7G8-strain (with a C-terminal V5 epitope tag). The P. berghei mutants PbHB3,  Pb7G8 and wild type P. berghei showed the same (in vitro and in vivo) sensitivity to chloroquine and amodiaquine.    

Attempts have been made to introduce a CVIET-type pfcrt allele (common in Africa) from the CQ-resistant Dd2 strain, which encodes 8 polymorphisms (M74I, N75E, K76T, A220S, Q271E, N326S, I356T, and R371I); however, attempts failed to obtain integration of this allele into the pbcrt locus.

See RMgm-612 for unsuccessful attempts to disrupt the crt gene of P. berghei, indicating an essential role of CRT during asexual blood stage development. In earlier studies in P. falciparum, the failure to disrupt pfcrt suggested an essential role of CRT for asexual blood stage viability (Waller et al., 2003, J. Biol. Chem. 278, 33593-601).

Other mutants
RMgm-611: A mutant in which the crt gene of P. berghei is replaced by the P. falciparum crt gene of the chloroquine (CQ) resistant 7G8-strain (with a C-terminal V5 epitope tag)
RMgm-612: unsuccessful attempt to disrupt crt of P. berghei
 


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1219500
Gene Model P. falciparum ortholog PF3D7_0709000
Gene productchloroquine resistance transporter
Gene product: Alternative nameCRT
Details of the genetic modification
Short description of the mutationcrt of P. berghei replaced by the (chlorquine-sensitive, HB3) P. falciparum crt gene (MAL7P1.27)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid HpaI, ScaI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationA 1.0-kb 5’ untranslated region (UTR) Sequence from pbcrt was amplified using primers c1 (CTTagatctTTTACTATTTTCAATTTCAACGGTGTG) and c2 (AAGgcgcgcTCCTGTcatatgTAATACACTGATTTAATATATTTAAAAAAATTG) and cloned into pLITMUS28 via BglII and BssHII to serve as the 5’ region of homology for recombination. The pfcrt cDNA from HB3 was generated using primers c5 (TTCacgcgtAAAAAGAATAATCAAAAGAATTCAAGCAAAAATGAC) and c6 (TTGTGTAATAATTGAATCGACG) and cloned into pBAD-Topo (Invitrogen) to introduce a C-terminal V5 epitope tag (GKPIPNPLLGLDST). Using primers c5 and c7 (AAGctcgagTTACGTAGAATCGAGACCGAGGAG), pfcrt-V5 was amplified from pBAD-Topo/pfcrt and inserted into the pLITMUS28 vector downstream of the pbcrt 5’UTR sequence via AflIII/BssHII (compatible sites) and XhoI. Then 0.7 kb of pycrt (PY05061) 3’UTR was amplified using primers c8 (CTTgaattcATATTTTTTTTAAATGCCACATAAAG) and c9 (AATctgcagGATATTTCAAAAATCTTAGCATAAGG) and inserted downstream of the pfcrt-V5 sequence via EcoRI and PstI to serve as the 3’ terminator for expression. A 1.0-kb pbcrt 3’UTR sequence was amplified using primers c3 (CTTggtaccCTTAAATGATTTTTGTAAATGCCAC) and c4 (AATaggcctGACGTTATGGCGACGTGTTGCC) and cloned via KpnI/StuI to serve as the 3’ region of homology. The transfection plasmid also contains the mutant Toxoplasma gondii dihydrofolate reductase-thymidylate synthase (tgdhfr-ts) selectable marker cassette.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6