Summary

RMgm-608
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0403200; Gene model (P.falciparum): PF3D7_0304600; Gene product: circumsporozoite (CS) protein (CS, CSP)
Details mutation: deletion of region 1 (amino acids KLKQP)
Phenotype Sporozoite; Liver stage;
Last modified: 5 March 2011, 10:31
  *RMgm-608
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21262960
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherA. Coppi; P. Sinnis
Name Group/DepartmentDepartment of Medical Parasitology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-608
Principal name∆RI
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are produced. Mutant sporozoites showed impaired ability (fivefold reduction) to invade hepatocytes in vitro. Motility and cell traversal of mutant sporozoites were normal.
Liver stageMutant sporozoites showed impaired ability (fivefold reduction) to invade hepatocytes in vitro. Liver stages (EEF's) that were formed in vitro showed normal morphology. Mutant sporozoites, intravenously injected into mice, showed a 15-fold reduction in infectivity compared to wild type sporozoites. A comparable reduction of infectivity was observed after intradermal inoculation of sporozoites.
Additional remarks phenotype

Mutant/mutation
In the mutant the wild type csp gene is replaced with a mutated csp gene, lacking region I (region I is a 5-aa sequence at the N terminus of the repeats; see figure below).

Protein (function)
The CS protein is the major protein on the surface of sporozoites and is critical for development of sporozoites within the oocysts and is involved in motility and invasion of both the salivary gland of the mosquito and the liver cells. The protein is also found on the oocyst plasma membrane and on the inner surface of the oocyst capsule. Specific motifs in CS are involved in sporozoite binding to mosquito salivary glands and in sporozoite attachment to heparan sulfate proteoglycans in the liver of the mammalian host. During substrate-dependent locomotion of sporozoites, CS is secreted at the sporozoite anterior pole, translocated along the sporozoite axis and released on the substrate at the sporozoite posterior pole. Following sporozoite invasion of hepatocytes, the CS is released in the host cell cytoplasm.

Phenotype
It has been shown that proteolytic processing of CSP occurs by a cysteine protease during invasion of hepatocytes. Processing occurs on the sporozoite surface (Coppi et al., 2005, J. Exp. Med. 201, 27-33).
Phenotype analyses of mutant  ∆RI indicate that proteolytic processing of CSP does not occur in the absence of region I. The normal development of salivary gland sporozoites indicates that processing does not play a significant role in the mosquito host. Mutant sporozoites showed impaired ability to invade hepatocytes in vitro. Liver stages (EEF's) that were formed showed normal morphology suggesting that that CSP cleavage is required specifically for productive invasion and not for downstream processes. Mutant sporozoites showed a comparable reduction in infectivity compared to wild type when inoculated either by the intradermal or intravenous route suggesting that processing of CSP is not required for sporozoite exit from the dermis. 

Additional information
Mutant ΔRI sporozoites expressed normal amounts of CSPΔRI and was exported in normal amounts to the sporozoite surface. In contrast to wt CSP, proteolytic processing of CSPΔRI was not detectable.

Overall,  the phenotypic analyses suggest that the CSP cleavage site lies within the highly conserved 5-aa sequence called region I and demonstrate that region I is required for rapid and complete processing of CSP. The phenotype of ΔRI sporozoites  establishes the link between CSP cleavage and hepatocyte invasion and demonstrates that efficient cleavage requires region I.

Moreover, evidence is presented that proteolytic processing of CSP is required for TSR exposure in the mammalian host, i.e., during hepatocyte invasion, but not for its exposure during sporozoite development in the mosquito host. The TSR domain is a known cell-adhesive motif C-terminal to the repeats termed the type I thrombospondin repeat (TSR).

See also mutant ∆Nfull (RMgm-609) in which the wild type csp gene is replaced with a mutated csp gene, lacking the N-terminal region (including Region I) excluding the signal sequence (see figure below)

 

Figure: Mutated csp genes from the different P. berghei mutant parasites as described in Coppi et al., 2011, J. Exp. Med. 208, 341-56. (RCon: wild type csp; ∆Nfull: see RMgm-609)

Other mutants
RMgm-609: A mutant in which the wild type csp gene is replaced with a mutated csp gene, lacking lacking the N-terminal region (including Region I) excluding the signal sequence


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0403200
Gene Model P. falciparum ortholog PF3D7_0304600
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCS, CSP
Details of the genetic modification
Short description of the mutationdeletion of region 1 (amino acids KLKQP)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationA mutant CSP gene was generated using a PCR-based approach. Two gene fragments flanking the region to be deleted and including engineered or endogenous restriction sites were amplified and cut to yield fragments that when ligated make a CSP mutant containing the desired deletion.

For the ∆RI CSP, the amino acids KLKQP were deleted using the following strategy: a 28-bp 5’ fragment from the CSP open reading frame was amplified by PCR using forward primer P1 (5’-GTATCACGTGCTTAACTCTAAG-3’; existing PmlI site underlined) and P2 (5’-GCAATATTATTACGCTCTATTTTTTCG-3’; introduced SspI site underlined). Next, a 776-bp 3’ CSP fragment was amplified using forward primer P3 (5’- AGCGTAATAATAAATTGAAACAAAGGCCTCCACCACCAAACCC- 3’; introduced StuI site underlined) and reverse primer P4 (5’- TTATTTAATTAAAGAATACTAATAC-3’; existing PacI site underlined). Both PCR products were gel purified, digested SspI and StuI (resp.) to remove region 1, and ligated. The correct PmlI-PacI ligation product was determined by pcr and subsequently sub-cloned, sequenced and cloned into the pCSComp transfection plasmid.

To generate the final pCSRep targeting construct that would replace the endogenous CSP locus, a CSP 5’UTR targeting region was cloned upstream of the selection cassette in pCSComp. The 5’UTR targeting region was obtained from p9.5∆E by PCR using p9.5∆E specific primers (see article)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GTATCACGTGCTTAACTCTAAG
Additional information primer 1P1 (PmlI); 5'CSP ORF forward
Sequence Primer 2GCAATATTATTACGCTCTATTTTTTCG
Additional information primer 2P2 (SspI); 5'CSP ORF reverse
Sequence Primer 3GAGCGTAATAATAAATTGAAACAAAGGCCTCCACCACCAAACCC
Additional information primer 3P3 (StuI); 3'CSP ORF forward
Sequence Primer 4GTTTATTTAATTAAAGAATACTAATAC
Additional information primer 4P4 (PacI); 3'CSP ORF reverse
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6