Summary

RMgm-604
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0302500; Gene model (P.falciparum): PF3D7_0204700; Gene product: hexose transporter (hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1)
Details mutation: The endogenous pbht1 gene is replaced with the P. falciparum ortholog, pfht1 (PFB0210c)
Phenotype Asexual bloodstage;
Last modified: 24 January 2011, 15:08
  *RMgm-604
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21169382
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). DNA constructs were transfected into P. berghei wild type or a P. berghei-GFP line.
The mutant parasite was generated by
Name PI/ResearcherM. Blume; N. Gupta
Name Group/DepartmentDepartment of Molecular Parasitology
Name InstituteHumboldt University
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-604
Principal nameΔpbht1-PfHT1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type. Mutant blood stages have been used to test the sensitivity PfHT1 in vivo to an inhibitor of HT1, the glucose analog C3361.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
In the mutant the endogenous hexose transporter 1 gene (pbht1) is replaced with the P. falciparum ortholog, pfht1 (PFB0210c)

Protein (function)
PbHT1 and it ortholog PfHT1 are facilitative hexose transporters in the Major Facilitator Superfamily of integral membrane proteins that mediates the uptake of glucose and fructose by the parasite. HT1 of P. falciparum is known to transport glucose and fructose and is essential for blood stage parasites, in vitro (see also mutants RMgm-390, RMgm-391 and 'Additional Information' below).

Phenotype
In the paper unsuccessful attempt to disrupt pbht1 are reported (see also RMgm-390). These unsuccessful attempts indicate an essential role of PbHT1 in the asexual blood stages. The replacement of the Pbht1 gene with the P. falciparum ortholog Pfht1 indicates that the protein PFHT1 can complement the P. berghei protein PbHT1. Mutant blood stages have been used to test the sensitivity PfHT1 in vivo to an inhibitor of HT1, the glucose analog C3361.

Additional information
In the paper it is shown that PbHT1 can transport glucose (Km~87 µM), mannose (Ki~93 µM), fructose (Ki~0.54 mM), and galactose (Ki~5 mM).
In the paper a mutant RMgm-603 is described in which the endogenous hexose transporter 1 gene (pbht1) is replaced with a HA-tagged copy of pbht1

Other mutants
RMgm-390: unsuccessful attempts to disrupt pbht1
RMgm-391: a mutant expressing a GFP-tagged form of PbHT1
RMgm-603: A mutant in which the endogenous hexose transporter 1 gene (pbht1) is replaced with a HA-tagged copy of pbht1.


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0302500
Gene Model P. falciparum ortholog PF3D7_0204700
Gene producthexose transporter
Gene product: Alternative namehexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1
Details of the genetic modification
Short description of the mutationThe endogenous pbht1 gene is replaced with the P. falciparum ortholog, pfht1 (PFB0210c)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe endogenous pbht1 gene is replaced with the P. falciparum ortholog, pfht1. Primers 1-4 show the primers used to amplify the 3'- and 5'-target regions of pbht1. Primer 5-6 are the primers to generate/amplify the P. falciparum ortholog, pfht1 (PFB0210c)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTCATCGCGGCCGCGCAAAACTAAATCGGATTAATGCCGA
Additional information primer 1PbHT1–5’UTR-F, NotI
Sequence Primer 2CTCATCGGATCCACGCAATATATTCATTTTTTCGTATTAATACACATATATTTCTTG
Additional information primer 2PbHT1–5’UTR-R, BamHI
Sequence Primer 3CTCATCGGGCCCCATACAAGAACACACCGGCAAT
Additional information primer 3PbHT1–3’UTR-F, ApaI
Sequence Primer 4CTCATCGGTACCCTTATGTTAAACAATTATCCTTTCCAATTATCACAC
Additional information primer 4PbHT1–3’UTR-R, KpnI
Sequence Primer 5CTCATCGGATCCAAAATGACGAAAAGTTCGAAAGATATATGTAGTGAG
Additional information primer 5PfHT1-F, BamHI
Sequence Primer 6CTCATCGGATCCTCATACAACCGACTTGGTCATATGC
Additional information primer 6PfHT1-R, BamHI