time = time(); $this->startSession(); } /** * startSession - Performs all the actions necessary to * initialize this session object. Tries to determine if the * the user has logged in already, and sets the variables * accordingly. Also takes advantage of this page load to * update the active visitors tables. */ function startSession(){ global $database; //The database connection session_start(); //Tell PHP to start the session /* Determine if user is logged in */ $this->logged_in = $this->checkLogin(); /** * Set guest value to users not logged in, and update * active guests table accordingly. */ if(!$this->logged_in){ $this->username = $_SESSION['username'] = GUEST_NAME; $this->userlevel = GUEST_LEVEL; $database->addActiveGuest($_SERVER['REMOTE_ADDR'], $this->time); } /* Update users last active timestamp */ else{ $database->addActiveUser($this->username, $this->time); } /* Remove inactive visitors from database */ $database->removeInactiveUsers(); $database->removeInactiveGuests(); /* Set referrer page */ if(isset($_SESSION['url'])){ $this->referrer = $_SESSION['url']; }else{ $this->referrer = "/"; } /* Set current url */ $this->url = $_SESSION['url'] = $_SERVER['PHP_SELF']; } /** * checkLogin - Checks if the user has already previously * logged in, and a session with the user has already been * established. Also checks to see if user has been remembered. * If so, the database is queried to make sure of the user's * authenticity. Returns true if the user has logged in. */ function checkLogin(){ global $database; //The database connection /* Check if user has been remembered */ if(isset($_COOKIE['cookname']) && isset($_COOKIE['cookid'])){ $this->username = $_SESSION['username'] = $_COOKIE['cookname']; $this->userid = $_SESSION['userid'] = $_COOKIE['cookid']; } /* Username and userid have been set and not guest */ if(isset($_SESSION['username']) && isset($_SESSION['userid']) && $_SESSION['username'] != GUEST_NAME){ /* Confirm that username and userid are valid */ if($database->confirmUserID($_SESSION['username'], $_SESSION['userid']) != 0){ /* Variables are incorrect, user not logged in */ unset($_SESSION['username']); unset($_SESSION['userid']); return false; } /* User is logged in, set class variables */ $this->userinfo = $database->getUserInfo($_SESSION['username']); $this->username = $this->userinfo['username']; $this->userid = $this->userinfo['userid']; $this->userlevel = $this->userinfo['userlevel']; return true; } /* User not logged in */ else{ return false; } } /** * login - The user has submitted his username and password * through the login form, this function checks the authenticity * of that information in the database and creates the session. * Effectively logging in the user if all goes well. */ function login($subuser, $subpass, $subremember){ global $database, $form; //The database and form object /* Username error checking */ $field = "user"; //Use field name for username if(!$subuser || strlen($subuser = trim($subuser)) == 0){ $form->setError($field, "* Username not entered"); } else{ /* Check if username is not alphanumeric */ if(!eregi("^([0-9a-z])*$", $subuser)){ $form->setError($field, "* Username not alphanumeric"); } } /* Password error checking */ $field = "pass"; //Use field name for password if(!$subpass){ $form->setError($field, "* Password not entered"); } /* Return if form errors exist */ if($form->num_errors > 0){ return false; } /* Checks that username is in database and password is correct */ $subuser = stripslashes($subuser); $result = $database->confirmUserPass($subuser, md5($subpass)); /* Check error codes */ if($result == 1){ $field = "user"; $form->setError($field, "* Username not found"); } else if($result == 2){ $field = "pass"; $form->setError($field, "* Invalid password"); } /* Return if form errors exist */ if($form->num_errors > 0){ return false; } /* Username and password correct, register session variables */ $this->userinfo = $database->getUserInfo($subuser); $this->username = $_SESSION['username'] = $this->userinfo['username']; $this->userid = $_SESSION['userid'] = $this->generateRandID(); $this->userlevel = $this->userinfo['userlevel']; /* Insert userid into database and update active users table */ $database->updateUserField($this->username, "userid", $this->userid); $database->addActiveUser($this->username, $this->time); $database->removeActiveGuest($_SERVER['REMOTE_ADDR']); /** * This is the cool part: the user has requested that we remember that * he's logged in, so we set two cookies. One to hold his username, * and one to hold his random value userid. It expires by the time * specified in constants.php. Now, next time he comes to our site, we will * log him in automatically, but only if he didn't log out before he left. */ if($subremember){ setcookie("cookname", $this->username, time()+COOKIE_EXPIRE, COOKIE_PATH); setcookie("cookid", $this->userid, time()+COOKIE_EXPIRE, COOKIE_PATH); } /* Login completed successfully */ return true; } /** * logout - Gets called when the user wants to be logged out of the * website. It deletes any cookies that were stored on the users * computer as a result of him wanting to be remembered, and also * unsets session variables and demotes his user level to guest. */ function logout(){ global $database; //The database connection /** * Delete cookies - the time must be in the past, * so just negate what you added when creating the * cookie. */ if(isset($_COOKIE['cookname']) && isset($_COOKIE['cookid'])){ setcookie("cookname", "", time()-COOKIE_EXPIRE, COOKIE_PATH); setcookie("cookid", "", time()-COOKIE_EXPIRE, COOKIE_PATH); } /* Unset PHP session variables */ unset($_SESSION['username']); unset($_SESSION['userid']); /* Reflect fact that user has logged out */ $this->logged_in = false; /** * Remove from active users table and add to * active guests tables. */ $database->removeActiveUser($this->username); $database->addActiveGuest($_SERVER['REMOTE_ADDR'], $this->time); /* Set user level to guest */ $this->username = GUEST_NAME; $this->userlevel = GUEST_LEVEL; } /** * register - Gets called when the user has just submitted the * registration form. Determines if there were any errors with * the entry fields, if so, it records the errors and returns * 1. If no errors were found, it registers the new user and * returns 0. Returns 2 if registration failed. */ function register($subuser, $subpass, $subemail){ global $database, $form, $mailer; //The database, form and mailer object /* Username error checking */ $field = "user"; //Use field name for username if(!$subuser || strlen($subuser = trim($subuser)) == 0){ $form->setError($field, "* Username not entered"); } else{ /* Spruce up username, check length */ $subuser = stripslashes($subuser); if(strlen($subuser) < 5){ $form->setError($field, "* Username below 5 characters"); } else if(strlen($subuser) > 30){ $form->setError($field, "* Username above 30 characters"); } /* Check if username is not alphanumeric */ else if(!eregi("^([0-9a-z])+$", $subuser)){ $form->setError($field, "* Username not alphanumeric"); } /* Check if username is reserved */ else if(strcasecmp($subuser, GUEST_NAME) == 0){ $form->setError($field, "* Username reserved word"); } /* Check if username is already in use */ else if($database->usernameTaken($subuser)){ $form->setError($field, "* Username already in use"); } /* Check if username is banned */ else if($database->usernameBanned($subuser)){ $form->setError($field, "* Username banned"); } } /* Password error checking */ $field = "pass"; //Use field name for password if(!$subpass){ $form->setError($field, "* Password not entered"); } else{ /* Spruce up password and check length*/ $subpass = stripslashes($subpass); if(strlen($subpass) < 4){ $form->setError($field, "* Password too short"); } /* Check if password is not alphanumeric */ else if(!eregi("^([0-9a-z])+$", ($subpass = trim($subpass)))){ $form->setError($field, "* Password not alphanumeric"); } /** * Note: I trimmed the password only after I checked the length * because if you fill the password field up with spaces * it looks like a lot more characters than 4, so it looks * kind of stupid to report "password too short". */ } /* Email error checking */ $field = "email"; //Use field name for email if(!$subemail || strlen($subemail = trim($subemail)) == 0){ $form->setError($field, "* Email not entered"); } else{ /* Check if valid email address */ $regex = "^[_+a-z0-9-]+(\.[_+a-z0-9-]+)*" ."@[a-z0-9-]+(\.[a-z0-9-]{1,})*" ."\.([a-z]{2,}){1}$"; if(!eregi($regex,$subemail)){ $form->setError($field, "* Email invalid"); } $subemail = stripslashes($subemail); } /* Errors exist, have user correct them */ if($form->num_errors > 0){ return 1; //Errors with form } /* No errors, add the new account to the */ else{ if($database->addNewUser($subuser, md5($subpass), $subemail)){ if(EMAIL_WELCOME){ $mailer->sendWelcome($subuser,$subemail,$subpass); } return 0; //New user added succesfully }else{ return 2; //Registration attempt failed } } } /** * editAccount - Attempts to edit the user's account information * including the password, which it first makes sure is correct * if entered, if so and the new password is in the right * format, the change is made. All other fields are changed * automatically. */ function editAccount($subcurpass, $subnewpass, $subemail){ global $database, $form; //The database and form object /* New password entered */ if($subnewpass){ /* Current Password error checking */ $field = "curpass"; //Use field name for current password if(!$subcurpass){ $form->setError($field, "* Current Password not entered"); } else{ /* Check if password too short or is not alphanumeric */ $subcurpass = stripslashes($subcurpass); if(strlen($subcurpass) < 4 || !eregi("^([0-9a-z])+$", ($subcurpass = trim($subcurpass)))){ $form->setError($field, "* Current Password incorrect"); } /* Password entered is incorrect */ if($database->confirmUserPass($this->username,md5($subcurpass)) != 0){ $form->setError($field, "* Current Password incorrect"); } } /* New Password error checking */ $field = "newpass"; //Use field name for new password /* Spruce up password and check length*/ $subpass = stripslashes($subnewpass); if(strlen($subnewpass) < 4){ $form->setError($field, "* New Password too short"); } /* Check if password is not alphanumeric */ else if(!eregi("^([0-9a-z])+$", ($subnewpass = trim($subnewpass)))){ $form->setError($field, "* New Password not alphanumeric"); } } /* Change password attempted */ else if($subcurpass){ /* New Password error reporting */ $field = "newpass"; //Use field name for new password $form->setError($field, "* New Password not entered"); } /* Email error checking */ $field = "email"; //Use field name for email if($subemail && strlen($subemail = trim($subemail)) > 0){ /* Check if valid email address */ $regex = "^[_+a-z0-9-]+(\.[_+a-z0-9-]+)*" ."@[a-z0-9-]+(\.[a-z0-9-]{1,})*" ."\.([a-z]{2,}){1}$"; if(!eregi($regex,$subemail)){ $form->setError($field, "* Email invalid"); } $subemail = stripslashes($subemail); } /* Errors exist, have user correct them */ if($form->num_errors > 0){ return false; //Errors with form } /* Update password since there were no errors */ if($subcurpass && $subnewpass){ $database->updateUserField($this->username,"password",md5($subnewpass)); } /* Change Email */ if($subemail){ $database->updateUserField($this->username,"email",$subemail); } /* Success! */ return true; } /** * isAdmin - Returns true if currently logged in user is * an administrator, false otherwise. */ function isAdmin(){ return ($this->userlevel == ADMIN_LEVEL || $this->username == ADMIN_NAME); } /** * generateRandID - Generates a string made up of randomized * letters (lower and upper case) and digits and returns * the md5 hash of it to be used as a userid. */ function generateRandID(){ return md5($this->generateRandStr(16)); } /** * generateRandStr - Generates a string made up of randomized * letters (lower and upper case) and digits, the length * is a specified parameter. */ function generateRandStr($length){ $randstr = ""; for($i=0; $i<$length; $i++){ $randnum = mt_rand(0,61); if($randnum < 10){ $randstr .= chr($randnum+48); }else if($randnum < 36){ $randstr .= chr($randnum+55); }else{ $randstr .= chr($randnum+61); } } return $randstr; } }; /** * Initialize session object - This must be initialized before * the form object because the form uses session variables, * which cannot be accessed unless the session has started. */ $session = new Session; /* Initialize form object */ $form = new Form; ?> RMgmDB - Rodent Malaria genetically modified Parasites - P. berghei

Summary

RMgm-603
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0302500; Gene model (P.falciparum): PF3D7_0204700; Gene product: hexose transporter (hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1)
Name tag: HA-tag
Phenotype Asexual bloodstage; Liver stage;
Last modified: 19 January 2013, 14:20
  *RMgm-603
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21169382
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). DNA constructs were transfected into P. berghei wild type or a P. berghei-GFP line.
The mutant parasite was generated by
Name PI/ResearcherM. Blume; N. Gupta
Name Group/DepartmentDepartment of Molecular Parasitology
Name InstituteHumboldt University
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-603
Principal nameΔpbht1-PbHT1-HA
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type. Immunofluorescence analysis using rabbit anti-HA antibody showed parasite surface location in parasite blood stages (schizonts)
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot different from wild type. Immunofluorescence analysis using rabbit anti-HA antibody showed the presence of PbHT1 on the plasma membrane of liver stages throughout the time course of 48 h. Merozoites budding out of multinucleated schizonts also displayed abundant PbHT1 protein at 68 h.
Additional remarks phenotype

Mutant/mutation
The endogenous hexose transporter 1 gene (pbht1) is replaced with a HA-tagged copy of pbht1.

Protein (function)
PbHT1 is a facilitative hexose transporter in the Major Facilitator Superfamily of integral membrane proteins that mediates the uptake of glucose and fructose by the parasite. HT1 of P. falciparum is known to transport glucose and fructose and is essential for blood stage parasites, in vitro (see also RMgm-390 and 'Additional information' below).

Phenotype
In the paper unsuccessful attempt to disrupt pbht1 are reported (see also RMgm-390). These unsuccessful attempts indicate an essential role of PbHT1 in the asexual blood stages.
Immunofluorescence analysis using rabbit anti-HA antibody showed parasite surface location in parasite blood stages (schizonts) and on the plasma membrane of liver stages. Normal production of  blood stages, sporozoites and liver stages indicates that the HA-tag does not affect the function of PbHT1.
See also the analyses of mutant RMgm-391, which expresses a (C-terminal) GFP-tagged form of PbHT1.

Additional information
In the paper it is shown that PbHT1 can transport glucose (Km~87 µM), mannose (Ki~93 µM), fructose (Ki~0.54 mM), and galactose (Ki~5 mM).
In the paper a mutant (RMgm-604) is described in which the endogenous hexose transporter 1 gene (pbht1) is replaced with the P. falciparum ortholog, pfht1

Other mutants
RMgm-390: unsuccessful attempt to disrupt pbht1
RMgm-391: a mutant expressing a GFP-tagged form of PbHT1
RMgm-604: a mutant in which the endogenous hexose transporter 1 gene (pbht1) is replaced with the P. falciparum ortholog, pfht1


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0302500
Gene Model P. falciparum ortholog PF3D7_0204700
Gene producthexose transporter
Gene product: Alternative namehexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1
Details of the genetic modification
Name of the tagHA-tag
Details of taggingC-terminal
Additional remarks: taggingThe endogenous pbht1 gene is replaced with a HA-tagged copy of pbht1.
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe endogenous pbht1 gene is replaced with a HA-tagged copy of pbht1. Primers 1-4 show the primers used to amplify the 3'- and 5'-target regions of pbht1. Primer 5-6 are the primers to generate/amplify the HA-tagged form of pbht1
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTCATCGCGGCCGCGCAAAACTAAATCGGATTAATGCCGA
Additional information primer 1PbHT1–5’UTR-F, NotI
Sequence Primer 2CTCATCGGATCCACGCAATATATTCATTTTTTCGTATTAATACACATATATTTCTTG
Additional information primer 2PbHT1–5’UTR-R, BamHI
Sequence Primer 3CTCATCGGGCCCCATACAAGAACACACCGGCAAT
Additional information primer 3PbHT1–3’UTR-F, ApaI
Sequence Primer 4CTCATCGGTACCCTTATGTTAAACAATTATCCTTTCCAATTATCACAC
Additional information primer 4PbHT1–3’UTR-R, KpnI
Sequence Primer 5CTCATCGCGGCCGCGCAAAACTAAATCGGATTAATGCCGA
Additional information primer 5PbHT1–5’UTR-F, NotI
Sequence Primer 6CTCATCGGATCCTTAAGCGTAATCTGGAACATCGTATGGGTAAACTCTTGATTTGCTTATATGTTTTTGTCTTTCTTC
Additional information primer 6PbHT1-HA-R, BamHI