RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-603
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0302500; Gene model (P.falciparum): PF3D7_0204700; Gene product: hexose transporter (hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1)
Name tag: HA-tag
Phenotype Asexual bloodstage; Liver stage;
Last modified: 19 January 2013, 14:20
  *RMgm-603
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21169382
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). DNA constructs were transfected into P. berghei wild type or a P. berghei-GFP line.
The mutant parasite was generated by
Name PI/ResearcherM. Blume; N. Gupta
Name Group/DepartmentDepartment of Molecular Parasitology
Name InstituteHumboldt University
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-603
Principal nameΔpbht1-PbHT1-HA
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type. Immunofluorescence analysis using rabbit anti-HA antibody showed parasite surface location in parasite blood stages (schizonts)
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot different from wild type. Immunofluorescence analysis using rabbit anti-HA antibody showed the presence of PbHT1 on the plasma membrane of liver stages throughout the time course of 48 h. Merozoites budding out of multinucleated schizonts also displayed abundant PbHT1 protein at 68 h.
Additional remarks phenotype

Mutant/mutation
The endogenous hexose transporter 1 gene (pbht1) is replaced with a HA-tagged copy of pbht1.

Protein (function)
PbHT1 is a facilitative hexose transporter in the Major Facilitator Superfamily of integral membrane proteins that mediates the uptake of glucose and fructose by the parasite. HT1 of P. falciparum is known to transport glucose and fructose and is essential for blood stage parasites, in vitro (see also RMgm-390 and 'Additional information' below).

Phenotype
In the paper unsuccessful attempt to disrupt pbht1 are reported (see also RMgm-390). These unsuccessful attempts indicate an essential role of PbHT1 in the asexual blood stages.
Immunofluorescence analysis using rabbit anti-HA antibody showed parasite surface location in parasite blood stages (schizonts) and on the plasma membrane of liver stages. Normal production of  blood stages, sporozoites and liver stages indicates that the HA-tag does not affect the function of PbHT1.
See also the analyses of mutant RMgm-391, which expresses a (C-terminal) GFP-tagged form of PbHT1.

Additional information
In the paper it is shown that PbHT1 can transport glucose (Km~87 µM), mannose (Ki~93 µM), fructose (Ki~0.54 mM), and galactose (Ki~5 mM).
In the paper a mutant (RMgm-604) is described in which the endogenous hexose transporter 1 gene (pbht1) is replaced with the P. falciparum ortholog, pfht1

Other mutants
RMgm-390: unsuccessful attempt to disrupt pbht1
RMgm-391: a mutant expressing a GFP-tagged form of PbHT1
RMgm-604: a mutant in which the endogenous hexose transporter 1 gene (pbht1) is replaced with the P. falciparum ortholog, pfht1


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0302500
Gene Model P. falciparum ortholog PF3D7_0204700
Gene producthexose transporter
Gene product: Alternative namehexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1
Details of the genetic modification
Name of the tagHA-tag
Details of taggingC-terminal
Additional remarks: taggingThe endogenous pbht1 gene is replaced with a HA-tagged copy of pbht1.
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe endogenous pbht1 gene is replaced with a HA-tagged copy of pbht1. Primers 1-4 show the primers used to amplify the 3'- and 5'-target regions of pbht1. Primer 5-6 are the primers to generate/amplify the HA-tagged form of pbht1
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTCATCGCGGCCGCGCAAAACTAAATCGGATTAATGCCGA
Additional information primer 1PbHT1–5’UTR-F, NotI
Sequence Primer 2CTCATCGGATCCACGCAATATATTCATTTTTTCGTATTAATACACATATATTTCTTG
Additional information primer 2PbHT1–5’UTR-R, BamHI
Sequence Primer 3CTCATCGGGCCCCATACAAGAACACACCGGCAAT
Additional information primer 3PbHT1–3’UTR-F, ApaI
Sequence Primer 4CTCATCGGTACCCTTATGTTAAACAATTATCCTTTCCAATTATCACAC
Additional information primer 4PbHT1–3’UTR-R, KpnI
Sequence Primer 5CTCATCGCGGCCGCGCAAAACTAAATCGGATTAATGCCGA
Additional information primer 5PbHT1–5’UTR-F, NotI
Sequence Primer 6CTCATCGGATCCTTAAGCGTAATCTGGAACATCGTATGGGTAAACTCTTGATTTGCTTATATGTTTTTGTCTTTCTTC
Additional information primer 6PbHT1-HA-R, BamHI