Summary

RMgm-587
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1023400; Gene model (P.falciparum): PF3D7_1419800; Gene product: glutathione reductase (GR)
Phenotype Asexual bloodstage; Oocyst; Sporozoite; Liver stage;
Last modified: 17 October 2010, 15:46
  *RMgm-587
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20852334
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherK. Buchholz; K. Becker; K. Matuschewski
Name Group/DepartmentInterdisciplinary Research Centre
Name InstituteJustus-Liebig University
CityGiessen
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-587
Principal nameGR(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageThe mutant showed a slight delay in initial proliferation of blood stages in mice.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystMutants produced lower numbers of oocysts in comparison with wild type parasites (although the differences were not significant). Mutant oocysts were significantly smaller than wild type oocysts and no sporozoites were formed.
SporozoiteNo production of oocyst- or salivary gland sporozoites
Liver stageNo production of oocyst- or salivary gland sporozoites. Infected mosquitoes were unable to infect mice by mosquito bite
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of glutathione reductase (GR).

Protein (function)
Plasmodium species have a fully functional glutathione (GSH) redox system. GSH is synthesized by the sequential action of gamma-glutamylcysteine synthase (γ-GCS) and GSH synthase; both of the genes encoding these enzymes are present in the Plasmodium. In addition, GSH is  generated by recycling GSSG back to GSH via glutathione reductase (GR). De novo synthesis of GSH is not essential for survival of  P. berghei blood stages. Blood stages of parasites lacking the enzyme γ-GCS (Δγ-gcs; RMgm-204) showed only a minor reduction in growth rate compared to wild type parasites.  In contrast, Δγ-gcs parasites show a complete block in oocyst development and were unable to produce infectious sporozoites. These results indicate that de novo synthesis of GSH is pivotal for development in the mosquito.

Phenotype
The phenotype analyses indicate that GR is not essential for blood stage development. In contrast, a dramatic effect of the lack of GR expression was observed on development of the parasites in the mosquito. Infection of mosquitoes resulted in (reduced numbers of) small oocysts that did not produce sporozoites.

Through disruption of the gene encoding γ-GCS it has been shown that de novo GSH synthesis is not critical for P. berghei blood stage multiplication but is essential for oocyst development. The phenotype analyses of mutant parasites lacking expression of GR confirms that GSH metabolism is critical for the mosquito oocyst stage.

See also the P. berghei mutants RMgm-403 and RMgm-404 which also lack the expression of GR and which show a similar phenotype as the mutant described here.

Additional information

Other mutants
RMgm-403: An independent mutant lacking expression of GR
RMgm-404: An independent mutant lacking expression of GR
RMgm-204: A mutant lacking expression of gamma-glutamylcysteine synthetase (γ-GCS).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1023400
Gene Model P. falciparum ortholog PF3D7_1419800
Gene productglutathione reductase
Gene product: Alternative nameGR
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, KpnI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1PbGR_Rep1for (SacII); 5' flanking region
Additional information primer 1TCCCCGCGGGTCAACAAATTACATTTATTGACGG
Sequence Primer 2PbGR_Rep1rev (NotI); 5' flanking region
Additional information primer 2GCGGCCGCATTTGTAGGTTTTTTTAAATGTGC
Sequence Primer 3PbGR_Rep2for (HindIII); 3' flanking region
Additional information primer 3CCCAAGCTTCGCATATTTTAATTCCTTAAAC
Sequence Primer 4PbGR_Rep2rev (KpnI); 3' flanking region
Additional information primer 4GGGGTACCGCTTATTTTGATTATGTACACG
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6