Summary

RMgm-586
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0824700; Gene model (P.falciparum): PF3D7_0923800; Gene product: thioredoxin reductase (TrxR)
Phenotype Oocyst; Sporozoite; Liver stage;
Last modified: 17 October 2010, 15:43
  *RMgm-586
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20852334
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherK. Buchholz; K. Becker; K. Matuschewski
Name Group/DepartmentInterdisciplinary Research Centre
Name InstituteJustus-Liebig University
CityGiessen
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-586
Principal nameTrxR(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocysts. Total number of midgut sporozoites was lower compared to midgut-sporozoite production of wild type parasites. The number of salivary gland sporozoites was comparable to wild type.
SporozoiteNormal numbers of oocysts. Total number of midgut sporozoites was lower compared to midgut-sporozoite production of wild type parasites. The number of salivary gland sporozoites was comparable to wild type. In vivo and in vitro infectivity (as measured by prepatent period in mice and in vitro development in HuH7 hepatoma cells) of isolated sporozoites was comparable to that of wild type sporozoites. Infectivity of mosquitoes infected with mutant parasites was lower than that of mosquitoes infected with wild type parasites
Liver stageIn vivo and in vitro infectivity (as measured by prepatent period in mice and in vitro development in HuH7 hepatoma cells) of isolated sporozoites was comparable to that of wild type sporozoites. Infectivity of mosquitoes infected with mutant parasites was lower than that of mosquitoes infected with wild type parasites
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of thioredoxin reductase (TrxR)

Protein (function)
Plasmodium parasites have a dual antioxidative system based on the cysteine- containing redox-active peptides glutathione (GSH) and thioredoxin (Trx). Glutathione is the major low molecular weight antioxidant in Plasmodium parasites, and it is kept at a high level in the reduced state by the antioxidant enzyme glutathione reductase (GR). Phenotype analyses of mutants lacking either expression of GR (RMgm-403, RMgm-404, RMgm-587) or of  gamma-glutamylcysteine synthase (RMgm-γ-GCS; 204) has provided evidence that GSH  metabolism is critical for development of the mosquito oocyst stage. Expression of GR or γ-GCS was not essential for the survival of the blood stages. In addition to the GSH system, a complete Trx system, consisting of NADPH, thioredoxin reductase (TrxR), Trx, and a number of Trx-dependent peroxidases, has been characterized in Plasmodium.

Phenotype
The phenotype analyses indicate a non-essential role of TrxR during blood stage development, mosquito development and development in the liver under normal growth conditions.

Additional information
It has been reported that it was impossible to disrupt the trxr gene of P. falciparum indicating that TrxR is essential for P. falciparum blood stages during in vitro development (Krnajski et al., 2002, J. Biol. Chem 277, 25970-975) . Possible explanations for the different results in the P. falciparum studies and the results presented here  include (i) frequently observed technical problems in the P. falciparum transfection system, (ii) an important role of TrxR for Plasmodium under in vitro culture conditions (which only partially reflect the physiological environment and lack feed-back regulation by the host), or (iii) a different role of TrxR in rodent and primate/human parasites

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0824700
Gene Model P. falciparum ortholog PF3D7_0923800
Gene productthioredoxin reductase
Gene product: Alternative nameTrxR
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, SacII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TrxR_Rep1for (KpnI); 5' flanking region
Additional information primer 1GGGGTACCGTGTGTGTAATATCATAATGAG
Sequence Primer 2TrxR_Rep1rev (HindIII); 5' flanking region
Additional information primer 2CCCAAGCTTGCGTGAAAATAATAAATGACAATTAC
Sequence Primer 3TrxR_Rep2for (SpeI); 3' flanking region
Additional information primer 3GGACTAGTGTGAAACACAATTGATTTATATGC
Sequence Primer 4TrxR_Rep2rev (SacII); 3' flanking region
Additional information primer 4TCCCCGCGGCGTACAGAAAACTGTGGCTTTCTTCAGG
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6