Summary

RMgm-57
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: sporozoite surface protein 2|thrombospondin-related anonymous protein (sporozoite surface protein 2; SSP2; SSP-2; TRAP)
Details mutation: The cytoplasmic tail domain (CTD) of TRAP replaced with the CTD of T. gondii MIC2
PhenotypeNo phenotype has been described
Last modified: 4 March 2010, 23:39
  *RMgm-57
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 10579715
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherS. Kappe, V. Nussenzweig, R. Menard
Name Group/DepartmentDepartment of Pathology, Kaplan Cancer Center
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-57
Principal nameTMIC
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of TRAP (thrombospondin-related anonymous protein) in which 37 carboxy-terminal residues of the cytoplasmic tail are replaced with the cytoplasmic tail of MIC2 which is a TRAP-related protein expressed by tachyzoites of Toxoplasma gondii.

Protein (function)
TRAP is a type 1 transmembrane protein, containing two adhesive domains in its extracellular portion, an A-domain of von Willebrand factor and a thrombospondin type I repeat (TSR, TSP). The cytoplasmic part (tail) of the protein is postulated to interact with actin–myosin motor proteins giving the force needed for motility. TRAP is located in the micronemes of sporozoites. The protein plays a role in the gliding motility of sporozoites and invasion of host cells as has been shown by analysis of mutant parasites lacking expression of TRAP  (RMgm-47; RMgm-53).

Phenotype
Analysis of the phenotype of mutants with a mutated cytoplasmic tail (RMgm-54; RMgm-55; RMgm-56) showed that the cytoplasmic tail is essential for sporozoite motility and invasion of host cells (infectivity). The lack of an effect on sporozoite motility and infectivity of the replacement of the Plasmodium cytoplasmic tail of TRAP with the cytoplasmic tail MIC2 of T. gondii shows that the function of the cytoplasmic tails is conserved between different species (despite little primary amino acid sequence similarity). The role of the different domains of the protein in motility and invasion has been analysed in other mutant parasites expressing mutated forms of TRAP (see below).

Other mutants
P. berghei mutants have been generated with mutated cytoplasmic tails of TRAP (RMgm-54; RMgm-55; RMgm-56RMgm-149, RMgm-150, RMgm-151).
Other P. berghei mutants have been generated with mutated extracellular (adhesive) domains (A-domain: RMgm-48; RMgm-49; TSR domain: RMgm-50; RMgm-51; A-domain and TSR domain: RMgm-52).
A P. berghei mutant has been generated in which the endogenous P. berghei trap was replaced with (mutated forms of) P. falciparum trap (RMgm-58)


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1349800
Gene Model P. falciparum ortholog PF3D7_1335900
Gene productsporozoite surface protein 2|thrombospondin-related anonymous protein
Gene product: Alternative namesporozoite surface protein 2; SSP2; SSP-2; TRAP
Details of the genetic modification
Short description of the mutationThe cytoplasmic tail domain (CTD) of TRAP replaced with the CTD of T. gondii MIC2
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct used results in 'disruption of the wild type trap-gene and introduction of a full length mutated trap gene under control of the wild type regulatory (3'UTR, 5'UTR) sequences.
The mutant expresses a mutated form of TRAP (thrombospondin-related anonymous protein) in which 37 carboxy-terminal residues of the cytoplasmic tail are replaced with the cytoplasmic tail of MIC2 which is a TRAP-related protein expressed by tachyzoites of Toxoplasma gondii. The DNA encoding the cytoplasmic tail of MIC2 was amplified from the XhoI fragment of BAC G11-11 (Wan et al., 1997) using 5'primer P27 (5'AAAACTGCAGGATCCCCATCCGCGGAGATAG 3') and 3'primer P28 (5'TGCTCTAGATATATATGTTTATTAAAATTACTCCATCCACATATCACTATCG 3')
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6