Summary

RMgm-54
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: sporozoite surface protein 2|thrombospondin-related anonymous protein (sporozoite surface protein 2; SSP2; SSP-2; TRAP)
Details mutation: Mutation in the cytoplasmic tail (abrogation of the tyrosine motif)
Phenotype Sporozoite; Liver stage;
Last modified: 4 March 2010, 23:37
  *RMgm-54
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 12615325
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherP. Bhanot, V. Nussenzweig, C. Persson
Name Group/DepartmentDepartment of Pathology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-54
Principal nameTRAPYI/AA mutant
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of midgut sporozoites are formed. Micronemal and cell surface localization of TRAP is affected (reduced) but not secretion of TRAP (into the culture medium). Gliding motility is affected (sporozoites formed about 60% as many trails as did wild type). Mutant sporozoites were affected in cell-traversal capacity as shown by the 'cell-wound assay' using Hepa1-6 cells (about twice as many dextran-rhodamine positive-Hepa1–6 cells in cultures of wild type sporozoites compared to culutes of mutant sporozoites). Sporozoites showed decreased infectivity to Hepa1-6 cells in vitro (mutant sporozoites had about 50–80% fewer EEFs than those infected by wild type parasites). Sporozoites showed decreased infectivity to BALB/c mice (parasite load in the mice infected with mutant sporozoites was 99% less compared with mice injected with wild type parasites).
Liver stageMutant sporozoites were affected in cell-traversal capacity as shown by the 'cell-wound assay' using Hepa1-6 cells (about twice as many dextran-rhodamine positive-Hepa1–6 cells in cultures of wild type sporozoites compared to culutes of mutant sporozoites). Sporozoites showed decreased infectivity to Hepa1-6 cells in vitro (mutant sporozoites had about 50–80% fewer EEFs than those infected by wild type parasites). Sporozoites showed decreased infectivity to BALB/c mice (parasite load in the mice infected with mutant sporozoites was 99% less compared with mice injected with wild type parasites).
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of TRAP (thrombospondin-related anonymous protein). In the mutated gene the tyrosine motif (Y562NFI) of its cytoplasmic tail was changed to A592CFA resulting in abrogation of the tyrosine motif (this motif conforms to the consensus of the YXXΦ sorting motif of proteins).

Protein (function)
TRAP is a type 1 transmembrane protein, containing two adhesive domains in its extracellular portion, an A-domain of von Willebrand factor and a thrombospondin type I repeat (TSR, TSP). The cytoplasmic part (tail) of the protein is postulated to interact with actin–myosin motor proteins giving the force needed for motility. TRAP is located in the micronemes of sporozoites. The protein plays a role in the gliding motility of sporozoites and invasion of host cells as has been shown by analysis of mutant parasites lacking expression of TRAP(RMgm-47; RMgm-53).

Phenotype
Analysis of the phenotype of the mutant with a mutated cytoplasmic tail (see 'Additional remarks genetic modification') shows that the mutation results in defective micronemal and cell surface localization of TRAP but does not affect secretion of TRAP (into the culture medium). The mutation affects motility, cell traversal, cell invasion and infectivity of sporozoites. The role of the different domains of the protein in motility and invasion has been analysed in other mutant parasites expressing mutated forms of TRAP (see below).

Other mutants
P. berghei mutants have been generated with mutated cytoplasmic tails of TRAP (RMgm-55; RMgm-RMgm-56; RMgm-57; RMgm-149; RMgm-150; RMgm-151).
Other P. berghei mutants have been generated with mutated extracellular (adhesive) domains (A-domain: RMgm-48; RMgm-49; TSR domain: RMgm-50; RMgm-51; A-domain and TSR domain: RMgm-52).
A P. berghei mutant has been generated in which the endogenous P. berghei trap was replaced with (mutated forms of) P. falciparum trap (RMgm-58)


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1349800
Gene Model P. falciparum ortholog PF3D7_1335900
Gene productsporozoite surface protein 2|thrombospondin-related anonymous protein
Gene product: Alternative namesporozoite surface protein 2; SSP2; SSP-2; TRAP
Details of the genetic modification
Short description of the mutationMutation in the cytoplasmic tail (abrogation of the tyrosine motif)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct used results in 'disruption of the wild type trap-gene and introduction of a full length mutated trap gene under control of the wild type regulatory (3'UTR, 5'UTR) sequences.
In the mutated gene the tyrosine motif (Y562NFI) of its cytoplasmic tail was changed to A592CFA resulting in abrogation of the tyrosine motif (this motif conforms to the consensus of the YXXΦ sorting motif of proteins).
The plasmid used to construct the mutant TRAPYI/AA is derived from the previously described plasmid INCO. pINCO contains a truncated copy of TRAP (missing nt 1–67). The insertion plasmid was created by replacing the AgeI–PstI fragment of TRAP open reading frame (ORF) in INCO with a PCR product carrying the mutation. The PCR product was generated using 5′ primer TRAP-AGE (CACCAAAACCGGTAGCTCCTC) that contains a site for AgeI and hybridizes from nt 840 onwards. The 3′ PCR primer was PB14SphSac (TTGCTGCAGCGCTACTTCCCGCGGCAAAGCATGCACCAACACCTATGCATCCAATT) that contains sites for PstI, SphI and SacII and hydridizes from nt 1720 onwards. The resulting PCR product was cloned into pCR 2.1-TOPO vector (Invitrogen), excised as a AgeI–PstI fragment and used to replace the corresponding fragment of INCO cut with AgeI and PstI. When the Y592NFI sequence was changed to A592CFA in TRAPYI/AA, SphI and SacI sites within the Y-motif. This allowed tagging the mutation and ruling out the possibility of it being corrected during the integration and recombination step, as occurs frequently in P. berghei. It was reasoned that the cysteine residue in the mutant motif was unlikely to be disruptive for the protein structure since the remainder of the TRAP tail does not contain cysteine residues required for the formation of disulfide bonds. Further, the mutant motif’s cysteine residue is in a position (Y XΦ) that does not require a specific amino acid.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6