RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-529
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1306900; Gene model (P.falciparum): PF3D7_1443000; Gene product: serine/threonine protein kinase (PfCLK-2)
Phenotype Liver stage;
Last modified: 21 December 2011, 14:19
  *RMgm-529
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20951971
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR. Tewari, O. Billker
Name Group/DepartmentUniversity of Nottingham
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-529
Principal nameK57
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stagetransmitted by mosquito bite
Additional remarks phenotype

The gene has been targeted for gene deletion using a construct aimed at integration into the genome by double cross-over homologous recombination

The gene has been targeted for disruption in a 'kinome-wide' study for deletion of genes encoding Plasmodium protein kinases (protein kinase-like proteins).

See the paper for additional information on the analysis of the phenotype.

See also Agarwal, S (2011; J Cell Biochem) for characterization of PfCLK-2 (PF14_0408) and negative attempts to disrupt this gene in P. falciparum: "four Plasmodium members have been identified of the cyclin-dependent kinase-like kinase (CLK) family. In other eukaryotes, CLKs regulate mRNA splicing through phosphorylation of Serine/Arginine-rich proteins. PfCLK-2 (PF14_0408) shows homology with the yeast Serine/Arginine protein kinase Sky1p and is transcribed throughout the asexual blood stages and in gametocytes. PfCLK-2 (PF14_0408) possesses one nuclear localization signal site upstream of the C-terminal catalytic domains. Indirect immunofluorescence, Western blot and electron microscopy data confirm that the kinases are primarily localized in the parasite nucleus".

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation as integration of the KO vector was not achieved. Accesibility of the locus to recombination was verified by C-terminal tagging.
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1306900
Gene Model P. falciparum ortholog PF3D7_1443000
Gene productserine/threonine protein kinase
Gene product: Alternative namePfCLK-2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption partial (deletion in 3' half including kinase domain)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGGCCCCATGATGAATCTAAAGGTTGTGTACG
Additional information primer 1primer sequence target region 1a
Sequence Primer 2GGGGAAGCTTGCTACTTATGTCAAATGGATATTTATTG
Additional information primer 2primer sequence target region 1b
Sequence Primer 3CCCCGAATTCGCTAGAGATGTATGTACAAACACGG
Additional information primer 3primer sequence target region 2a
Sequence Primer 4GGGGTCTAGACATCAATTGGATCCTCCTTAGG
Additional information primer 4primer sequence target region 2b
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6