RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-522
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1460500; Gene model (P.falciparum): PF3D7_1247500; Gene product: serine/threonine protein kinase, putative (cyclin-G associated kinase, gak)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 21 December 2011, 16:18
  *RMgm-522
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20951971
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR. Tewari, O. Billker
Name Group/DepartmentUniversity of Nottingham
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-522
Principal nameK28 gak
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteOokinete numbers (in vitro) reduced to 5% of wild type
OocystOocyst numbers (day 12-14) reduced to 3% of wild type. The remaining oocyst (day 12-14) larger than wild type
Sporozoiteno sporozoites
Liver stageNot tested
Additional remarks phenotype

The gene has been targeted for gene deletion using a construct aimed at integration into the genome by double cross-over homologous recombination

The gene has been targeted for disruption in a 'kinome-wide' study for deletion of genes encoding Plasmodium protein kinases (protein kinase-like proteins).

See the paper for additional information on the analysis of the phenotype.

Disruption of the P. falciparum ortholog has been succesful (Solyakov et al., 2011, Nat Commun, 2:565) indicating that this gene is not essential for asexual proliferation.
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1460500
Gene Model P. falciparum ortholog PF3D7_1247500
Gene productserine/threonine protein kinase, putative
Gene product: Alternative namecyclin-G associated kinase, gak
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption partial (3' half deleted, including kinase domain)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGGCCCCACACACAAGAAATACCAATAATACAC
Additional information primer 1primer sequence target region 1a
Sequence Primer 2GGGGAAGCTTCTAAGGGTATATGCATAAACCAAG
Additional information primer 2primer sequence target region 1b
Sequence Primer 3CCCCGAATTCGATGAGGCGTTTGGTATACAGTTC
Additional information primer 3primer sequence target region 2a
Sequence Primer 4GGGGTCTAGACCTTGAAAAGGTGGTAACAATGCTG
Additional information primer 4primer sequence target region 2b
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6