RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-509
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1319000; Gene model (P.falciparum): PF3D7_1455300; Gene product: conserved Plasmodium protein, unknown function
PhenotypeNo phenotype has been described
Last modified: 21 December 2011, 09:56
  *RMgm-509
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 2
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22184632
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 676m1cl1 (RMgm-29)
Other information parent line676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter (PubMed: PMID: 16242190).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherJ. Fonager, E.M. Pasini, C.J. Janse, B.M Franke-Fayard
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center (LUMC)
CityLeiden
CountryThe Netherlands
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1319000
Gene Model P. falciparum ortholog PF3D7_1455300
Gene productconserved Plasmodium protein, unknown function
Gene product: Alternative name
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid XbaI/Asp718I
Partial or complete disruption of the geneUnknown
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationName of unsuccessful attempts: exp. 1493/1518
The gene has been targeted for disruption/deletion using a construct for targeted gene disruption by double cross-over homologous recombination. The primers of the two target sequences of the gene are provided below.
The unsuccessful attempts to disrupt the gene might indicate an essential function during asexual blood stage development.
The gene has been selected for targeted gene disruption based on its presence in a proteome of membranes of infected red blood cells.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATCTAGACTGTTGCATGTTGCATATGG
Additional information primer 1F1 primer
Sequence Primer 2AGAATTCGCTTCTGTTTGTTATGTCTTGG
Additional information primer 2R1 primer
Sequence Primer 3AAAGCTTGTGTCATCATGATTTTCATTGC
Additional information primer 3F2 primer
Sequence Primer 4AGGTACCTGATTATGTATACATCAGAGTG
Additional information primer 4R2 primer
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren