RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-4138
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1035200; Gene model (P.falciparum): PF3D7_1407000; Gene product: LCCL domain-containing protein | scavenger receptor-like protein (PbSR; P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; CCP3)
Details mutation: The pentaxin (PTX) domain removed
Phenotype Oocyst; Sporozoite;
Last modified: 21 April 2017, 18:09
  *RMgm-4138
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 28414172
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherTremp AZ; Dessens JT
Name Group/DepartmentPathogen Molecular Biology Department, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene and Tropical Medicine
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-4138
Principal name∆PTX/EGFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocysts are formed. Highly reduced formation of sporozoites within the oocysts.
SporozoiteNormal numbers of oocysts are formed. Highly reduced formation of sporozoites within the oocysts.
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of PbSR (P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; LCCL domain containing protein CCp3). The mutated protein lacks the pentaxin (PTX) domain from the PbSR protein which is (c-terminal) tagged with EGFP.

Protein (function)
The pbsr gene is a member of a small conserved gene family, encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's. PbSR contains four LCCL domains; a LH2 (lipoxygenase homology 2) domain; two SR (scavenger receptor cysteine-rich) domains and a PTX/LamG (pentraxin/laminin-G) domain related to concanavalin A-like module.  

Phenotype
Phenotype analyses of mutants lacking the complete PbSR protein (RMgm-113, RMgm-114) indicate a role of PbSR in the formation of sporozoites in the oocyst (see also Additional information). The phenotype analyses of the mutant that expresses the mutated form of PbSR indicate that the PTX domain is essential for sporozoite formation.

As an internal control for the LAP1∆SRCR/GFP parasite (RMgm-115) we also generated a new parasite line named LAP1∆PTX/GFP, which expresses LAP1::GFP without its pentaxin (PTX) domain. Like LAP1∆SRCR/GFP parasites (RMgm-115), LAP1∆PTX/GFP parasites failed to form crystalloids and generated oocysts, the large majority of which failed to produce sporozoites. However, compared to LAP1∆SRCR/GFP, pull down from LAP1∆PTX/GFP ookinetes yielded considerably higher levels of LAP4, LAP5 and LAP6, albeit the amounts were reduced compared to ookinetes expressing the full-length LAP1. These observations indicate that the SRCR and PTX modules of LAP1 contribute differentially to the formation of the complete LAP complex. Moreover, the very similar phenotypes of these LAP1 mutant parasites indicate that the relative amounts of individual LAPs within the complex is equally important for its function.

Additional information
The protein is expressed in female gametocytes and in ookinetes. In the ookinetes PbSR is associated with crystalloids, transient organelles that form in developing ookinetes and disappear after ookinete-to-oocyst transition (Carter, V. et al., 2008, Mol. Microbiol. 68, 1560-1569; RMgm-116).

From the abstract:
Successful sporogony of Plasmodium berghei in vector mosquitoes requires expression of a family of six modular proteins named LCCL lectin domain adhesive-like proteins (LAPs). The LAPs share a subcellular localization in the crystalloid, a unique parasite organelle that forms during ookinete development. Here, LAP interactions in P. berghei were studied using a series of parasite lines stably expressing reporter-tagged LAPs combined with affinity purification and high accuracy label free quantitative mass spectrometry. Our results show that abundant complexes containing LAP1, LAP2 and LAP3 are formed in gametocytes through high avidity interactions. Following fertilization, LAP4, LAP5 and LAP6 are recruited to this complex, a process that is facilitated by LAP1 chiefly through its scavenger receptor cysteine-rich modules. These collective findings provide new insight into the temporal and molecular dynamics of protein complex formation that lead up to, and are required for, crystalloid biogenesis and downstream sporozoite transmission of malaria parasites.

Other mutants
RMgm-113: A mutant lacking PbSR
RMgm-114: A mutant lacking PbSR
RMgm-116: A mutant expressing a GFP- and mCherry-tagged version of PbSR
RMgm-117: A mutant expressing a GFP- tagged version of PbSR

RMgm-115: A mutant containing a mutated form of PbSR: Two central SRCR (scavenger receptor) domains removed


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1035200
Gene Model P. falciparum ortholog PF3D7_1407000
Gene productLCCL domain-containing protein | scavenger receptor-like protein
Gene product: Alternative namePbSR; P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; CCP3
Details of the genetic modification
Short description of the mutationThe pentaxin (PTX) domain removed
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII double digest
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo study the role of the pentaxin (PTX) domain of LAP1 we generated by allelic replacement a parasite line expressing LAP1::GFP without its PTX domain, named LAP1∆PTX/GFP. One μg of plasmid pDNR-PbSR/EGFP served as template in PCR using primers deltaPTX-F (GGCTAGCTGATGGTATGTCTGGAAATAGAGACATAAATAC) and deltaPTX-R (ATACCATCAGCTAGCCATTGAAAAGTTGGTTC). After PCR amplification the template DNA was digested with DpnI and the amplicon DNA circularized via In-Fusion PCR cloning to give plasmid pDNR-deltaPTX/EGFP. The LAP1-specific insert contained within pDNR-deltaPTX/EGFP was then introduced into pLP-DHFR/SR via Cre-LoxP site-specific recombination to give the transfection vector pLP-deltaPTX/EGFP. Prior to performing transfections, plasmid DNA was digested with KpnI and SacII to remove the vector backbone.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6