Summary

RMgm-404
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1023400; Gene model (P.falciparum): PF3D7_1419800; Gene product: glutathione reductase (GR)
Phenotype Oocyst; Sporozoite;
Last modified: 4 July 2010, 10:58
  *RMgm-404
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20573956
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 820cl1m1cl1 (RMgm-164)
Other information parent lineP. berghei ANKA 820cl1m1cl1 (RMgm-164) is a reference ANKA mutant line which expresses GFP under control of a male and RFP under control of a female gametocyte specific promoter (PubMed: PMID: 19438517).
The mutant parasite was generated by
Name PI/ResearcherR. Pastrana-Mena; B. Franke-Fayard; C.J. Janse; A.E. Serrano
Name Group/DepartmentDepartment of Microbiology
Name InstituteUniversity of Puerto Rico-School of Medicine
CitySan Juan
CountryPuerto Rico, USA
Name of the mutant parasite
RMgm numberRMgm-404
Principal name1513cl1
Alternative nameΔgr4
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystMutant oocysts numbers in Anopheles stephensi, counted at day 10-12 post infection, were slightly lower than those produced by wild type parasites and the size of mutant oocysts at day 10-12 was significantly smaller compared to the size of wild type oocysts with a maximum size that is comparable to immature 6-8 days wt oocysts.
The small oocysts that are present at day 10-12 showed a highly vacuolated cytoplasm and the absence of sporozoite formation. No sporozoites were observed in A. stephensi salivary glands at day 21-22 post infection
SporozoiteThe small oocysts that are present at day 10-12 showed a highly vacuolated cytoplasm and the absence of sporozoite formation. No sporozoites were observed in A. stephensi salivary glands at day 21-22 post infection
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of glutathione reductase (GR).
In this mutant, Δgr4, the complete gr gene was replaced with the hdhfr/yfcu selectable marker cassette.
See RMgm-403 for an independent mutant (Δgr3) lacking expression of GR. In this mutant  a ~700 bp region of the gr gene was replaced with the hdhfr/yfcu selectable marker cassette.

Protein (function)
Plasmodium species have a fully functional glutathione (GSH) redox system. GSH is synthesized by the sequential action of gamma-glutamylcysteine synthase (γ-GCS) and GSH synthase; both of the genes encoding these enzymes are present in the Plasmodium. In addition, GSH is  generated by recycling GSSG back to GSH via glutathione reductase (GR). De novo synthesis of GSH is not essential for survival of  P. berghei blood stages. Blood stages of parasites lacking the enzyme γ-GCS (Δγ-gcs; RMgm-204) showed only a minor reduction in growth rate compared to wild type parasites.  In contrast, Δγ-gcs parasites show a complete block in oocyst development and were unable to produce infectious sporozoites. These results indicate that de novo synthesis of GSH is pivotal for development in the mosquito.

Phenotype
The phenotype analyses indicate that GR is not essential for blood stage development. In contrast, a dramatic effect of the lack of GR expression was observed on development of the parasites in the mosquito. Infection of mosquitoes resulted in reduced numbers of stunted oocysts that did not produce sporozoites.

Through disruption of the gene encoding γ-GCS it has been shown that de novo GSH synthesis is not critical for P. berghei blood stage multiplication but is essential for oocyst development. The phenotype analyses of mutant parasites lacking expression of GR confirms that GSH metabolism is critical for the mosquito oocyst stage.  

Attempts to generate parasites lacking GR and γ-GCS by simultaneous disruption of gr and γ-gcs were unsuccessful (see 'Additional Information'). This demonstrates that the maintenance of cytosolic GSH levels required for blood stage survival is dependent on either de novo GSH synthesis or GSSG reduction by Plasmodium GR.

Additional information
Parasites lacking GR showed the same sensitivity to methylene blue and Eosin B as wild type parasites demonstrating that these compounds target other molecules than GR.

In order to examine whether blood stage parasites can survive without de novo synthesis of GSH and without a functional GR attempts were performed to disrupt the γ-gcs in a mutant lacking GR expression. For these experiments the ∆gr3 (RMgm-403) mutant was generated which lacks a drug-selectable marker to enable us to take advantage of the γ-gcs disruption construct which contains the tgdhfr selectable marker (RMgm-204). The drug selectable marker, a fusion of the hdhfr and yfcu genes, was removed from the genome by negative selection with 5-fluorocytosine. Three attempts to disrupt the γ-gcs gene using two different constructs (pL1217, pL1223) in the ∆gr3 mutant were unsuccessful whereas wild type parasites were readily transfected with the same constructs (RMgm-204). In addition, attempts were performed to disrupt the gr gene in γ-gcs mutants (∆γ-gcs1,2; RMgm-204) with construct a construct containing the hdhfr as a selectable marker, allowing selection of mutants using treatment with WR99210. In 5 attempts it was not possible to select parasites with both the γ-gcs and the gr genes disrupted. These results indicate that the maintenance of cytosolic GSH levels needed for blood stage survival requires either de novo GSH synthesis or the formation of GSH through reduction of GSSG by a Plasmodium GR. These results also strongly suggest that blood stage parasites cannot depend solely on host-derived GSH and GR for their GSH metabolism.

Other mutants
RMgm-403: An independent  mutant lacking expression of gluthatione reductase (GR). In this mutant, Δgr3,  a ~700 bp region of the gr gene was replaced with the hdhfr/yfcu selectable marker cassette. The mutant does not contain a drug selectable marker which has been removed by the negative selection procedure using the negative selectable marker yfcu (yeast cytosine deaminase and uridyl-phosphoribosyltransferase) and the drug 5-fluorocytosine (5-FC)(Braks et al., 2006, Nucleic Acids Res 34, e39).
RMgm-204: A mutant lacking expression of gamma-glutamylcysteine synthetase (γ-GCS).

 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1023400
Gene Model P. falciparum ortholog PF3D7_1419800
Gene productglutathione reductase
Gene product: Alternative nameGR
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTT
CTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGC
TCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA
CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT
GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG
GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATG
ACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAG
GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTA
GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA
CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG
GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG
CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCT
GATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG
CTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
ATTGTGAGCGGTAAACAATTTCACACAGGAAACAGCTTGACCATGATTACGCCAAGCTTG
TGTGTTATAAGGCCTGTAAGTGTCACTAATTTTAATACAGTCATAAAAAAAATGAGAAAA
TAAATAATTAAATAATGAAAAGAAATGCACAATATATTAAAAATATAGAGGCCTTTCTAT
ATTTACTATTTATGTATATTAAATAGGATATTCAAAAAAAAAATTGTATTCCCTTTAATC
CTTTATTATTACTAACAAAAATATTATTTTTTTTTATTATAACATAGCCATGATAAAAAT
TCAAAAACAATTACCCAAATTAAAAATCGTATAATTTATTTGTAAAGAAAATAGATACTT
TTATGTAAAATACTTAAATGTACTTAGTATTGTGAATGTTTTTTTCGCTGGAAATTAATA
AAAAAAAAATAAGAGTTACTTTATAAGCTCGTATAAAAATGTTTGCGGTCGAAAATATAA
TGCTTATGACAATACAAACTTGTAAAATAGTACTAATTTTAAACAAGTATTAATACTATT
TTATATTTCGCCAACGTTTTTAGCCTCATTTTAAACTTTTTAAAAATATTTTTTAGCATA
TATTTACATACATACATATATATATTATATACGTGCATTTTTTCGTATCCTTTTATTCCC
CATTTTTCCACTTTTTATTTTTTTCTTATTAAATTTTAAAATTTAGATATATAATTAAAA
CAAAAAAAAATAGTAATAATAATAACAAATCATGTATAAATTAAAATATGTTTTTTTTTA
TTGTTTTTTTAATTTGGCAATTAAATTAACAAGTGGTTTTAGTCTTCTTAACAATTTCGA
TATTCATACGAACAAAGCACATTTAAAAAAACCTACAAATATGGTTTATGATTTAATCGC
CGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATATTTATACCAATT
GATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCA
CATGCATGTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTT
TACACACATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAAT
TTATGACCATATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGAC
AAAATTATTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTC
ATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAA
AAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCG
ATTGATAATTCCTGCAGCCCAGCTTAATTCTTTTCGAGCTCTTTATGCTTAAGTTTACAA
TTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCTAGATATTGTGCTTTAAATGCTC
ACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAATACCATTAAATTTTCAAAAAAA
TACTATGCATATAATGTTATACATATAAACATAAAACGCCATGTAAATCAAAAAATATAT
AAAAATATGTATAAAAATAAATATGCACTAAATATAAGCTAATTATGCATAAAAATTAAA
GTGCCCTTTATTAACTAGAACTAGTCGTAATTATTTATATTTCTATGTTATAAAAAAATC
CTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTTTATAATTTTAATATAA
AATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGAAACAAAAAACGTAATT
TTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTAAAATATATATACTTTG
TGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAAAAATTTTATAAAACAT
AGGGGGATCCATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCAT
CGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAACGAATTTAGATATTTCCAGAG
AATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGAC
CTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAG
CAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGC
CTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGG
TGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGAC
AAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATA
TAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAA
GTACAAATTTGAAGTATATGAGAAGAATGATGCTAGCGGAGGAGGTGGATCTGGTGGAGG
TGGAAGTGCTAGCGTGACAGGGGGAATGGCAAGCAAGTGGGATCAGAAGGGTATGGACAT
TGCCTATGAGGAGGCGGCCTTAGGTTACAAAGAGGGTGGTGTTCCTATTGGCGGATGTCT
TATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGGTCACAACATGAGATTTCAAAAGGG
ATCCGCCACACTACATGGTGAGATCTCCACTTTGGAAAACTGTGGGAGATTAGAGGGCAA
AGTGTACAAAGATACCACTTTGTATACGACGCTGTCTCCATGCGACATGTGTACAGGTGC
CATCATCATGTATGGTATTCCACGCTGTGTTGTCGGTGAGAACGTTAATTTCAAAAGTAA
GGGCGAGAAATATTTACAAACTAGAGGTCACGAGGTTGTTGTTGTTGACGATGAGAGGTG
TAAAAAGATCATGAAACAATTTATCGATGAAAGACCTCAGGATTGGTTTGAAGATATTGG
TGAGGCTTCGGAACCATTTAAGAACGTCTACTTGCTACCTCAAACAAACCAATTGCTGGG
TTTGTACACCATCATCAGAAATAAGAATACAACTAGACCTGATTTCATTTTCTACTCCGA
TAGAATCATCAGATTGTTGGTTGAAGAAGGTTTGAACCATCTACCTGTGCAAAAGCAAAT
TGTGGAAACTGACACCAACGAAAACTTCGAAGGTGTCTCATTCATGGGTAAAATCTGTGG
TGTTTCCATTGTCAGAGCTGGTGAATCGATGGAGCAAGGATTAAGAGACTGTTGTAGGTC
TGTGCGTATCGGTAAAATTTTAATTCAAAGGGACGAGGAGACTGCTTTACCAAAGTTATT
CTACGAAAAATTACCAGAGGATATATCTGAAAGGTATGTCTTCCTATTAGACCCAATGCT
GGCCACCGGTGGTAGTGCTATCATGGCTACAGAAGTCTTGATTAAGAGAGGTGTTAAGCC
AGAGAGAATTTACTTCTTAAACCTAATCTGTAGTAAGGAAGGGATTGAAAAATACCATGC
CGCCTTCCCAGAGGTCAGAATTGTTACTGGTGCCCTCGACAGAGGTCTAGATGAAAACAA
GTATCTAGTTCCAGGGTTGGGTGACTTTGGTGACAGATACTACTGTGTTTAACTCGATCC
CGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTA
TGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAAC
ATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAG
CCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAAATTTAGATATTT
ATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTATTATTATTTTTAC
TGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATG
TTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATA
AACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCGTTGCTATAAATGCGGGGCGATT
ATTAGCTGATAGAATTTTTTTAAATAAAACAAGAAAAACAAATTATAGTCTTATTCCAAC
TGTTATATTTTCACACCCACCTATAGGAACAATAGGTTTATCTGAAGAAGAAGCAATAAA
TATATATGGAAAGGAAAATGTTAAAATATATGAATCCAAATTTACAAACTTATTTTTTTC
TGTATATGATATAGAACCAAGTCAAAAAGAAAAAACTTATATTAAATTAGTATGTGTTGG
AAAAGAGGAGTTAATTAAAGGATTACATATAATAGGATTAAATGCGGATGAAATCATACA
AGGTTTTGCAGTAGCATTAAAAATGAATGCGACAAAAAAAGATTTTGATGAGACAATTCC
AATTCATCCAACAGCTGCTGAAGAACTTGTAACTTTACATCCATGGATGAAGTAAATATA
AAAAATAAATTGCGCATATTTTAATTCCTTAAACTACTTTCTGGTGATGTATCATTATTA
TACATCCATTATTTATTCTCATGTTTGGGAACACATAAATGTGGGAAAATAGCTAATCAT
TTGTATTACTCTTAAATAGGTATATTATATTCCTTCAAAATATATTTGTGTTTTCTTAAA
ATAAGATGACAAAATAAGGGATATGATCAAAGAAGGGATATCTGATCACCCGGGGCGGCC
GCG
Restriction sites to linearize plasmid HindIII, EcoRI, PvuI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gccAAGCTTGTGTGTTATAAGGCCTGTAAGTGTC
Additional information primer 1L4530 (HindIII); 5'gr targeting region
Sequence Primer 2TCCCCGCGGCGATTAAATCATAAACCATATTTG
Additional information primer 2L4049 (SacII); 5'gr targeting region
Sequence Primer 3cggGGTACCGTTGCTATAAATGCGGGGCGATTATTAGCTG
Additional information primer 3L3680 (EcoRV); 3'gr targeting region
Sequence Primer 4ccgGATATCCCTTCTTTGATCATATCCCTTATTTTGTC
Additional information primer 4L3681 (KpnI); 3'gr targeting region
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6