RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-395

Malaria parasite	P. yoelii
Genotype
Tagged	Gene model (rodent): PY17X_0502200; Gene model (P.falciparum): PF3D7_1016900; Gene product: early transcribed membrane protein 10.3 \| protein of early gametocyte 4 (UIS4, up-regulated in infective sporozoites, ETRAMP10.3) Name tag: c-myc
Phenotype	No phenotype has been described

Last modified: 16 September 2015, 18:47

*RMgm-395

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 20228203
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. yoelii
Parent strain/line	P. y. yoelii 17XNL
Name parent line/clone	Not applicable
Other information parent line	17XNL is a non-lethal strain of P. yoelii
top of page
The mutant parasite was generated by
Name PI/Researcher	D.C. MacKellar; S.H.I. Kappe
Name Group/Department	Not applicable
Name Institute	Seattle Biomedical Research Institute, University of Washington
City	Seattle
Country	USA
top of page
Name of the mutant parasite
RMgm number	RMgm-395
Principal name	Pyuis4myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Not different from wild type
Oocyst	Not different from wild type
Sporozoite	Not different from wild type
Liver stage	Not different from wild type
Additional remarks phenotype	Mutant/mutation In the mutant the endogenous uis4 gene (up-regulated in infective sporozoites 4) is replaced with a C-terminal myc-tagged copy of uis4. Protein (function) UIS4 has been identified by transcription-profiling of P. berghei sporozoites (Kaiser et al., (2001). Mol. Microbiol. 51, 1221-32). The protein is expressed in sporozoites and throughout liver stage development and localizes to the parasitophorous vacuole membrane. Mutant parasites lacking expression of UIS4 (RMgm-35, RMgm-38) produce normal numbers of sporozoites that are able to infect liver cells. These parasites are however unable to develop into mature liver stages Phenotype The mutant shows a normal development throughout the life cycle. It produces infective sporozoites and liver stage development is comparable to that of wild type parasites, indicating that the myc-tag does not affect the function of the protein. Mutant parasites lacking expression of UIS4 (RMgm-35, RMgm-38) produce normal numbers of sporozoites that are able to infect liver cells. These parasites are however unable to develop into mature liver stages. Additional information Other mutants RMgm-35, RMgm-38: P. berghei/P. yoelii mutants lacking expression of UIS4

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PY17X_0502200

Gene Model P. falciparum ortholog

PF3D7_1016900

Gene product

early transcribed membrane protein 10.3 | protein of early gametocyte 4

Gene product: Alternative name

UIS4, up-regulated in infective sporozoites, ETRAMP10.3

top of page

Details of the genetic modification

Name of the tag

c-myc

Details of tagging

C-terminal

Additional remarks: tagging

4x tandem myc epitope tag

Commercial source of tag-antibodies

anti-myc (Santa Cruz Biotechnology SC-789, Santa Cruz, CA)

Type of plasmid/construct

(Linear) plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

SacII, KpnI

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

To create the PyUIS4myc construct, the PyUIS4 promoter and ORF were amplified as one product using the primers SP/PyUIS4Prom-B3D and ASP/PyUIS4-B3D and inserted into the B3D-myc vector with the SacII and SpeI enzymes. The PyUIS4 3’ untranslated region was amplified from 17XNL genomic DNA using the primers SP/PyUIS4-B3D/3’UTR and ASP/PyUIS4-B3D/3’UTR, and this was inserted into the B3D-myc vector containing PyUIS4 with the HindIII and KpnI enzymes. This construct was digested with SacII and KpnI, and transfected into P.yoelii 17XNL schizonts.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	CCGCGGGCTTCTTTGAGCAAATACTG
Additional information primer 1	SP/PyUIS4Prom-B3D (Promoter PyUIS4)
Sequence Primer 2	ACTAGTTATGTATGGGTCAAATGGTT
Additional information primer 2	ASP/PyUIS4-B3D (ORF PyUIS4)
Sequence Primer 3	AAAAGCTTTTCATTATGAGGGTAATTCAGAAAG
Additional information primer 3	SP/PyUIS4-B3D/3'UTR (PyUIS4 3'UTR)
Sequence Primer 4	AAGGTACCGACTTTTAAAAATAATATATATGAAA
Additional information primer 4	ASP/PyUIS4-B3D/3'UTR (PyUIS4 3'UTR)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page