Summary

RMgm-390
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0302500; Gene model (P.falciparum): PF3D7_0204700; Gene product: hexose transporter (hexose transporter 1; PfHT1, PfHT, PbHT)
PhenotypeNo phenotype has been described
Last modified: 23 January 2011, 11:28
  *RMgm-390
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20132450
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherK. Slavic; R. Tewari; S. Krishna
Name Group/DepartmentCentre for Infection, Cellular and Molecular Medicine
Name InstituteSt. George's University of London
CityLondon
CountryUK

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0302500
Gene Model P. falciparum ortholog PF3D7_0204700
Gene producthexose transporter
Gene product: Alternative namehexose transporter 1; PfHT1, PfHT, PbHT
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe unsuccessful attempts to disrupt PbHT indicate an essential function during asexual blood stage growth (see also RMgm-603 for reports of unsuccessful attempts to disrupt pbht (pbht1)).

In the same paper, unsuccessful attempts are reported to disrupt the hexose transporter (PfHT) in P. falciparum.

PfHT is a facilitative hexose transporter in the Major Facilitator Superfamily of integral membrane proteins that mediates the uptake of glucose and fructose by the parasite. Pfht is a single copy gene in the P. falciparum genome with no close paralogues. Three other proteins, PFI0955w, PFI0785c and PFE1455w have been annotated with putative sugar transport function, although they have diverged considerably from typical sugar transporters (21%, 13% and 7% amino acid sequence identity compared with PfHT, respectively). Unlike PfHT, PFI0955w and PFI0785c are expressed only late in the asexual cycle.

In the same paper it is reported that P. berghei parasites with a GFP-tagged version of PbHT were readily generated (see RMgm-391). This demonstrates that the locus is accessible for genetic targeting and confirms the essentiality of the hexose transporter gene for completion of the erythrocytic asexual cycle of malaria parasites.

See also mutant RMgm-604 in which the endogenous hexose transporter 1 gene (pbht1) is replaced with the P. falciparum ortholog, pfht1.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1cgaGGTACCGTGTAAAAATTTATCGTTAAGAGAG
Additional information primer 1Pb1 (KpnI); PbHT 5' UTR
Sequence Primer 2CATGGGCCCTTTTTTCGTATTAATACACATATATTTCTTG
Additional information primer 2Pb2 (ApaI); PbHT 5' UTR
Sequence Primer 3gtcGATATCATTTTGATACGCATAAATCGTATAGATATAG
Additional information primer 3Pb7 (EcoRV); PbHT 3' UTR
Sequence Primer 4caaGCGGCCGCAAAAAAATAGAAATCAAATGATATATATTTACCC
Additional information primer 4Pb8 (NotI); PbHT 3' UTR
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6