RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-353
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1002100; Gene model (P.falciparum): PF3D7_0404400; Gene product: 6-cysteine protein (P36, Pbs36)
Phenotype Liver stage;
Last modified: 15 April 2010, 07:19
  *RMgm-353
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20386715
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherM.R. van Dijk; C.J. Janse
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-353
Principal name261cl1; 276cl1
Alternative nameΔp36
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageSee remarks below ('Phenotype')
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of the P36 protein.

Protein (function)
The P36 protein is a member of a small family of proteins, the 6-cysteine (cys) family of (surface) proteins. The proteins are characterized by domains of roughly 120 amino acids in size that contain six positionally conserved cysteines (6-cys). Although some species of Plasmodium (may) contain unique members of the 6-cys family, ten members have been identified that are conserved both in structure as well as in genome organization throughout the genus. Some of the conserved 6-cys proteins are encoded by genes that form paralogous gene-pairs which are closely linked in the genome separated by less then 2 kb of intergenic region. Most members have a GPI anchor and are predicted membrane surface proteins whereas others appear to be secreted and most members are expressed in a discrete stage-specific manner in gametocytes, sporozoites or merozoites (see also 'Additional Information'). Evidence has been presented that P36 is  expressed both in gametocytes and in sporozoites.

Phenotype
Phenotype analyses indicate that P36 is not essential during the complete life cycle. Gametocyte production, fertilisation, oocyst and sporozoite production were comparable to wild type parasites. Liver stage development was only analysed by measuring prepatent periods after feeding of infected mosquitoes on mice. No differences were observed in prepatent periods compared to wild type parasites. These observations are in contrast to observations made in an independent mutant lacking expression of P36 (RMgm-45). This mutant showed a strongly reduced sporozoite infectivity.

Additional information
The p36 gene forms a paralogous gene pair with the gene p36p (PB000891.00.0; PFD0215c), which are closely linked in the genome.
 

Table: P. falciparum gene members of the 6-cys family

Gene P. falciparum Gene P. falciparum
p48/45  PF13_0247 p12p  PFF0620c
p47  PF13_0248 p230p  PFB0400w
p36  PFD0210c p230  PFB0405w
p52  PFD0215c p38  PFE0395c
p12  PFF0615c p41  PFD0240c


Other mutants
RMgm-45: An independent P. berghei mutant lacking expression of P36.
A P. berghei mutant (RMgm-42) has been generated that lacks the expression of not only this protein but also its paralogue P36p (PB000891.00.0; p36p).
A P. yoelii mutant (RMgm-43) has been generated that lacks the expression of not only this protein but also its paralogue P36p (PY01340; p36p).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1002100
Gene Model P. falciparum ortholog PF3D7_0404400
Gene product6-cysteine protein
Gene product: Alternative nameP36, Pbs36
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BamHI, KpnI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Of the 932bp coding sequence, the first 330bp remain intact
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCAAGCTTGGATCCGCATTTTTGTTGACGCTACTG
Additional information primer 1L862 (HindIII,BamHI); Pbs36F 5'ko
Sequence Primer 2CCCAAGCTTGACTTTTTAATATAACTCCAGGC
Additional information primer 2L863 (HindIII); Pbs36R 5'ko
Sequence Primer 3GGATATCCGATTTAGCATCTCATCATGG
Additional information primer 3L864 (EcoRV); Pbs36F 3'ko
Sequence Primer 4CGGGGTACCTGGTACTGCGAAAATCACACC
Additional information primer 4L865 (KpnI); Pbs36R 3'ko
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6