RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-298
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1418900; Gene model (P.falciparum): PF3D7_1320600; Gene product: ras-related protein Rab-11A
PhenotypeNo phenotype has been described
Last modified: 27 June 2009, 16:37
  *RMgm-298
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19165333
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherC. Agop-Nersesian; M. Meissner; G. Langsley
Name Group/DepartmentHygieneinstitut, Department of Parasitology
Name InstituteUniversity Hospital Heidelberg
CityHeidelberg
CountryGermany
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1418900
Gene Model P. falciparum ortholog PF3D7_1320600
Gene productras-related protein Rab-11A
Gene product: Alternative name
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid HindIII/EcoRI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Leaving the first small exon
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationRab genes encode a subgroup of small GTP-binding proteins within the ras super-family that regulate targeting and fusion of transport vesicles within the secretory and endocytic pathways. In the genome of P. falciparum 11 genes have been identified that encode Rab GTPases.
Rab11A is highly conserved in apicomplexan parasites.
Parasites expressing GFP-Rab11A throughout the asexual blood cycle (RMgm-299) has been generated to analyse expression in blood stages. This analysis confirmed data from IFA, RT-PCR and microarray data that expression occurs during development of the trophozoite into the schizont and free merozoites. A rather diffuse, vesicular localisation of GFP-Rab11A was found in trophozoites and gametocytes, whereas in schizonts, a clear apical-like localisation was observed. The results indicate that Rab11A has a dynamic localisation during intra-erythrocytic development associating with rhoptries only after their biogenesis. The changing distribution of Rab11A indicate that the GTPase could be performing non-rhoptry associated functions during development of the parasite within red blood cells. Based on studies in both Toxoplasma gondii and P. falciparum evidence is presented in this paper that Rab11A mediated transport might be involved in Inner Membrane Complex (IMC) maturation and IMC interaction with the plasma membrane and also might deliver components of the proto-glidosome to the IMC. It is speculated that Rab11A transports vesicles derived from endosome-like compartments, similar to its known function in other eukaryotes.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GTTAAAAAAAGCTTTTAGGTAATTATAA
Additional information primer 1PbRab11a-5′UTR-For (HindIII)
Sequence Primer 2CCTGGACTGCAGGTTTGATTTCC
Additional information primer 2PbRab11a-5′UTR-Rev (PstI)
Sequence Primer 3GCAAATTTTGGGTACCAAATTATAAC
Additional information primer 3PbRab11a-3′UTR-For (KpnI)
Sequence Primer 4CCTTTGCATATGCAGAATTCGGGA
Additional information primer 4PbRab11a-3′UTR-Rev (EcoRI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren