Back to search resultsSummaryRMgm-283
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 19438517 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | M. Ponzi, C.J. Janse, P. Alano |
Name Group/Department | Dipartimento di Malattie Infettive, Parassitarie e Immunomediate |
Name Institute | Istituto Superiore di Sanità |
City | Rome |
Country | Italy |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-283 |
Principal name | 678cl1; 721cl1 |
Alternative name | Δmdv-1/peg3 |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Normal numbers of male and female gametocytes are produced. Both male and female gametocytes showed a strong reduction in egress from the host erythrocyte, resulting in strongly decreased fertilisation rates. |
Fertilization and ookinete | Gametocytes were strongly impaired in their capacity to produce mature ookinetes. Although small numbers of ookinetes were formed, they represented at most 6% (range 0–6%) of the ookinete production observed in wild type parasites. The small number of ookinetes produced normal oocysts and infectious sporozoites. |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Not different from wild type |
Additional remarks phenotype | Mutant/mutation Additional information An independent mutant lacking expression of MDV-1/PEG3 has been described (RMgm-231) that showed a slightly different phenotype. Both female and male gametocytes were strongly impaired in fertilisation and production of ookinetes. In addition, ookinetes lacking expression of MDV-1/PEG3 showed an impaired development, suggesting of an additional role of MDV-1/PEG3 in the ookinete stage. Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1432200 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1216500 | ||||||||||||||||||||||||
Gene product | male development gene 1 | protein of early gametocyte 3 | ||||||||||||||||||||||||
Gene product: Alternative name | MDV-1; PEG3; MDV-1/PEG3 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
ATCCCCTGAAGAAGAAATTGATCATTTTGCAGATGATTTAACTGATAAATATGAAGTTAA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | MluNI/XbaI | ||||||||||||||||||||||||
Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | First 122 bp of the 645bp ORF intact | ||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |