RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-232
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1006200; Gene model (P.falciparum): PF3D7_0408600; Gene product: sporozoite invasion-associated protein 1 (Sporozoite Invasion-Associated Protein-1; SIAP-1; SIAP-1/ag17/S5)
Name tag: mCherry
Phenotype Oocyst; Sporozoite; Liver stage;
Last modified: 23 April 2009, 20:28
  *RMgm-232
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19181869
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherS. Engelmann; K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-232
Principal namesiap-1/mcherry
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystSIAP-1/mCherry oocysts produced normal numbers of sporozoites, which invaded mosquito salivary glands.
SporozoiteSIAP-1/mCherry oocysts produced normal numbers of sporozoites, which invaded mosquito salivary glands. Normal numbers of salivary gland sporozoites were formed that were infective C57/BL6 mice.
The fusion protein SIAP-1/mCherry was abundantly expressed in oocyst-derived and salivary gland sporozoites. In both immature and mature sporozoites, the protein showed a polarized distribution predominant at the apical tip of the parasites. In addition to this apical concentration, SIAP-1/mCherry was also detected as distinct patches distributed along the parasite.
Liver stageNormal numbers of salivary gland sporozoites were formed that were infective C57/BL6 mice.
In transforming sporozoites 4h post-infection of HepG2 cells in vitro, SIAP-1/mCherry was detected in distinct patches, without clear apical polarization. These dotted structures were still detected 24h post-infection, although at a lower intensity, but had completely disappeared in mature liver stages 72h post-infection
Additional remarks phenotype

Mutant/mutation
The mutant expresses a (C-terminal) mCherry-tagged form of SIAP-1 (Sporozoite Invasion-Associated Protein-1).

Protein (function)
SIAP-1 orthologs have been found exclusively in apicomplexan hemoprotozoa, parasites that are transmitted by arthropod vectors, e.g., Plasmodium, Babesia, and Theileria species (and is absent in, for example,  Toxoplasma and Cryptosporidium).  SIAP1 was first discovered in a systematic screen for P. falciparum sporozoite antigens recognized by sera from individuals that were immunized with irradiated sporozoites and termed antigen 17 (ag17). Subsequently, the P. yoelii ortholog was isolated in a suppression subtractive hybridization screen for genes that are specifically upregulated in sporozoites (S5) compared to blood stages. Mutant parasites lacking expression of SIAP-1 showed defects in egress of sporozoites from the oocysts and invasion of the salivary gland by the sporozoites (see RMgm-109, RMgm-233, RMgm-234).

Phenotype
The phenotype analyses indicate that the C-terminal tagging of SIAP-1 had no detrimental effect on P. berghei infectivity. The phenotype analyses indicate specific expression of SIAP-1 in sporozoites and liver stages. In both immature and mature sporozoites, the SIAP-1/mCherry protein showed a polarized distribution predominant at the apical tip of the parasites. In addition to this apical concentration, SIAP-1/mCherry was also detected as distinct patches distributed along the parasite. These patches were sometimes clearly distributed at the periphery of the parasite, suggesting a possible association of SIAP-1 with the sporozoite pellicle.

Additional information
No change in the distribution of SIAP-1/mCherry was observed during the gliding of motile sporozoites.

Other mutants
RMgm-109: A mutant lacking expression of SIAP-1
RMgm-233: A mutant lacking expression of SIAP-1
RMgm-234: A mutant lacking expression SIAP that expresses GFP under control of the sporozoite specific csp promoter.


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1006200
Gene Model P. falciparum ortholog PF3D7_0408600
Gene productsporozoite invasion-associated protein 1
Gene product: Alternative nameSporozoite Invasion-Associated Protein-1; SIAP-1; SIAP-1/ag17/S5
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: taggingA parasite line was generated expressing the endogenous SIAP-1 protein fused to the
mCherry red fluorescent protein. This was achieved by transfection of a targeting vector that contain an amino-terminally truncated PbSIAP-1 copy and in-frame fusion of the mCherry coding region, followed by the DHFR/TS 3’ untranslated region.
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SpeI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATAAGAATGCGGCCGCGCATCTGAAAGTAAAGGAAAATGGGTCGC
Additional information primer 1mCherry-SIAP-1for (NotI)
Sequence Primer 2GGGCTAGCTGAATTGTCCACGAAAACACTGTAACTATAGG
Additional information primer 2mCherry- SIAP-1rev (NheI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6