Summary

RMgm-198
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0812400; Gene model (P.falciparum): PF3D7_0911300; Gene product: cysteine repeat modular protein 1 (CRMP1)
Phenotype Oocyst; Sporozoite; Liver stage;
Last modified: 13 March 2009, 19:28
  *RMgm-198
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17253978
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherJ. Thompson; C.J.Janse; A.P. Waters
Name Group/DepartmentInstitute of Immunology and Infection Research
Name InstituteSchool of Biological Sciences
CityEdinburgh
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-198
Principal name205cl1; 212cl1
Alternative namecrmp1-
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocysts are produced. Normal numbers of oocyst-derived (hemolymph) sporozoites are formed. Sporozoites do not invade the salivary gland.
SporozoiteNormal numbers of oocysts are produced. Normal numbers of oocyst-derived (hemolymph) sporozoites are formed. Sporozoites do not invade the salivary gland. Sporozoites do not transmit to the mouse by infected mosquito bite. Intravenous inoculation of sporozoites results in blood stage infections, although at a lower efficiency compared to wild type sporozoites.
Liver stageSporozoites do not invade the salivary gland. Sporozoites do not transmit to the mouse by infected mosquito bite. Intravenous inoculation of sporozoites results in blood stage infections, although at a lower efficiency compared to wild type sporozoites.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Cysteine Repeat Modular Proteins (CRMP1)

Protein (function)
The Cysteine Repeat Modular Proteins (CRMP1–4) of Plasmodium, are encoded by a small gene family that is conserved in malaria and other Apicomplexan parasites. They are very large, predicted surface proteins with multipass transmembrane domains containing motifs that are conserved within families of cysteine-rich, predicted surface proteins in a range of unicellular eukaryotes, and a unique combination of protein-binding motifs, including a > 100 kDa cysteine-rich modular region, an epidermal growth factor-like domain and a Kringle domain.

Phenotype
The phenotype analyses indicate that CRMP1 is not essential for blood stage development and for the formation of sporozoites. CRMP1 is essential for sporozoite targeting into the mosquito salivary gland and therefore for transmission of the parasite from the mosquito to the mouse.

Additional information
CRMP1 is expressed both in asexual blood stages and in oocysts and sporozoites. Evidence has been presented for a location on the erythrocyte membrane of schizont infected red blood cells. No evidence was found for an effect on blood stage development as a result of the lack of expression of CRMP1 in the blood stages. The growth of mutant parasites in mice was comparable to wild type parasites. It has been suggested that domains of this protein may play a role in immune regulation by binding to host immune molecules and thereby modifying the course of the immune response.

Other mutants
RMgm-199: A mutant lacking expression of CRMP2


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0812400
Gene Model P. falciparum ortholog PF3D7_0911300
Gene productcysteine repeat modular protein 1
Gene product: Alternative nameCRMP1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Gene knockout was carried out by homologous recombination resulting in replacement of sequences encoding the NH2-terminal region (including the KD of PbCRMP1), CRM, EGF-like and mTM domains of crmp1 by the tgdhfr-ts gene
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationGene knockout was carried out by homologous recombination resulting in replacement of sequences encoding the NH2-terminal region (including the KD of PbCRMP1), CRM, EGF-like and mTM domains of crmp1 by the tgdhfr-ts gene
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GAGAATCGATAAACAGTTCTAATTTCCTTCG
Additional information primer 1F6 (ClaI); crmp1 5'
Sequence Primer 2GAGAAAGCTTAGGTATTTCCTATAAATCCGTTGC
Additional information primer 2R6 (HindIII); crmp1 5'
Sequence Primer 3GAGAACTAGTCCTGATAACACAATGTCG
Additional information primer 3F7 (SpeI); crmp1 3'
Sequence Primer 4GAGAGCGGCCGACGGCTAATTGGCGTG
Additional information primer 4R7 (EagI); crmp1 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6