RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-156
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1212600; Gene model (P.falciparum): PF3D7_1014200; Gene product: male gamete fusion factor HAP2, putative (HAP2; GCS1, Generative Cell Specific 1)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 28 January 2011, 14:07
  *RMgm-156
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18403203
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherM. Hirai; H. Matsuoka
Name Group/DepartmentDivision of Medical Zoology, Department of Infection and Immunity
Name InstituteJichi Medical University School of Medicine
CityShimotsuke City
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-156
Principal namePbGCS1(-) (clone 1-3; 2-5; 3-6)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNormal numbers of male and female gametocytes are produced. Gamete formation was comparable to that of wild type parasites, as determined by light microscopy of exflagellation (male gamete formation) and escape of females from the host erythrocyte.
Male gametes are sterile as shown by the lack of fertilisation when the mutant males are crossed with fertile female gametes.
Mutant female gametes are fertile as shown by cross-fertilisation with wild type male gametes.
Fertilization and ookineteGamete formation was comparable to that of wild type parasites, as determined by light microscopy of exflagellation (male gamete formation) and escape of females from the host erythrocyte.
Male gametes are sterile as shown by the lack of fertilisation when the mutant males are crossed with fertile female gametes.
Mutant female gametes are fertile as shown by cross-fertilisation with wild type male gametes.
Mutant males gametes showed flagella motility and adhesion to surrounding erythrocytes, forming exfagellating centers comparable to wild type. However, no successful entering of flagella into female gametes was observed.
OocystNo ookinete and oocyst formation (see phenotype 'Fertilization and ookinete').
SporozoiteNo sporozoite formation (see phenotype 'Fertilization and ookinete' and 'Oocyst').
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of GCS1 (Generative Cell Specific 1; HAP2)

Protein (function)
In Arabidopsis the male-specific sterility protein HAP2 has been identified by a genetic screen (HAP mutants: containing haploid-disrupting (hapless) mutations; Johnson M.A. et al., 2004, Genetics 168, 971-82) . A HAP2 family member called GCS1 (for generative cell-specific) was subsequently identified in a screen for lily genes whose transcripts were up-regulated in sperm (generative cells) . GCS1/HAP2 is conserved and members were found in rice, Chlamydomonas, a red alga, a slime mold, Plasmodium falciparum, and Leishmania major.

Phenotype
The phenotype analyses indicate a role of GCS1/HAP2 in fertilisation. Female gametes are fertile, whereas male gametes are sterile. Male gametes are able to attach to female gametes but fusion of the gametes does not occur

Additional information
GenBank accession no. XM_671808.

Other mutants
RMgm-155: An independent mutant lacking expression of HAP2/GCS1.
RMgm-157: A mutant expressing a GFP-tagged form of HAP2/GCS1
RMgm-167: A mutant expressing a GFP-tagged form of HAP2/GCS1
RMgm-158: A mutant expressing GFP under the control of the hap2/gcs1 promoter
RMgm-605: A mutant expressing a mutated form of HAP2/GCS1 lacking the HAP2-GCS1 (HG) domain
RMgm-606: A mutant expressing a mutated form of HAP2/GCS1 lacking the entire C-terminal region downstream from the TM domain
RMgm-607: A mutant expressing a mutated form of HAP2/GCS1 lacking the TM domain and the entire C-terminal region downstream from the TM domain


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1212600
Gene Model P. falciparum ortholog PF3D7_1014200
Gene productmale gamete fusion factor HAP2, putative
Gene product: Alternative nameHAP2; GCS1, Generative Cell Specific 1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Part of the 5' and 3' pbgcs1 coding region was used as targetting sequences.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAGCTTAGTGAGATTAAAGGTGATGAG
Additional information primer 1GCS1F1 (HindIII); 5'
Sequence Primer 2AAGCTTGATGATACATCATTGTAATA
Additional information primer 2GCS1R1 (HindIII); 5'
Sequence Primer 3GAATTCTGATGAATATGTATGTAAATG
Additional information primer 3GCS1F2 (EcoRI); 3'
Sequence Primer 4GGATCCTGACGGAGATGTATCTGC
Additional information primer 4GCS1R2 (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6