RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-120
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0417600; Gene model (P.falciparum): PF3D7_0903800; Gene product: LCCL domain-containing protein (LAP6; LCCL/lectin adhesive-like protein 6; CCp4)
Phenotype Oocyst; Sporozoite;
Last modified: 19 February 2009, 21:14
  *RMgm-120
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17335349
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherJ.D. Raine; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-120
Principal name∆pblap6
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocysts are produced. Sporozoite formation within the oocysts is blocked. The diameters of oocysts were significantly larger than that of wild type on days 14 and 21 of infection. Light microscopy revealed the presence of two distinct populations of oocysts: those that displayed a phenotype reminiscent of immature wild type oocysts (i.e., non-sporulated), and those that appeared vacuolated/degenerate compared to wild type.
SporozoiteNo midgut sporozoites were observed on day 10/11 p.i. By day 18 p.i., reduced numbers (typically 0%–12%) of sporozoites were observed in dissected midguts. The number of sporozoites in salivary gland preparations infections was consistently reduced to <1% of wild type. The expression and targeting of the circumsporozoite protein in midgut sporozoites was indistinguishable from that in wild type.
To test if the observed sporozoites were infectious to mice, infected mosquitoes were allowed to feed on mice on days 21 and 28 p.i. Blood stage parasites were observed in all mice bitten by wild type-infected mosquitoes when screened on day 4/5 post-bite. In contrast, mice bitten by mutant-infected mosquitoes remained uninfected.
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of LAP6 (LCCL/lectin adhesive-like protein 6; LCCL domain containing protein CCp4)

Protein (function)
The lap6 (ccp4) gene is a member of a small conserved gene family, encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's.

Phenotype
Phenotype analyses indicate a role during oocyst development and sporozoite formation/production (see also additional information).

Additional information
Crossings of the mutant females with wild type males did not rescue the formation/production of sporozoites. Crossing of the mutant males with wild type females resulted in wild type production of sporozoites that were infectious to C57BL/6 mice. The lack of rescue of the ∆pblap6 mutant phenotype by crossing of mutant females with wild type males is suggestive of a role of LAP6 within a few hours after fertilisation.

Other members of the LAP/CCp family of proteins have been analysed by targeted gene disruption. A number of mutants lacking expression of these proteins show a comparable defect in development of oocysts and formation of sporozoites (RMgm-113, RMgm-114, RMgm-115: LAP1/PbSLAP/PbSR/CCp3; RMgm-119: LAP4/CCp2; RMgm-98: LAP5/FNPA; RMgm-118: LAP2, CCp1).

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0417600
Gene Model P. falciparum ortholog PF3D7_0903800
Gene productLCCL domain-containing protein
Gene product: Alternative nameLAP6; LCCL/lectin adhesive-like protein 6; CCp4
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI/BamHI double digest
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Integration of the targeting cassette into the genome leads to replacement of the central 4525bp of the coding region of pblap6 (4732bp)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCCATGAAAATATTTACGCATACGC
Additional information primer 1AE25a-pblap6 (ApaI); 5'
Sequence Primer 2CCAAGCTTCAAAAAAGTCCCAGAACAAAATG
Additional information primer 2AE25b-pblap6 (HindIII); 5'
Sequence Primer 3TGAATTCCATATACCAATCAACCAAGATAC
Additional information primer 3AE25c-pblap6 (EcoRI); 3'
Sequence Primer 4GGGGATCCTATGTAAACATTAATCAATGATG
Additional information primer 4AE25d-pblap6 ((BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6