Back to search resultsSummaryRMgm-1143
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25418785 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Guerreiro A; Mair GR |
Name Group/Department | Instituto de Medicina Molecular |
Name Institute | Faculdade de Medicina da Universidade de Lisboa |
City | Lisbon |
Country | Portugal |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1143 |
Principal name | 2186 |
Alternative name | PBANKA_010770::GFP |
Standardized name | |
Is the mutant parasite cloned after genetic modification | No |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | mRNA present but absence of the GFP-tagged protein (translationally repressed) |
Fertilization and ookinete | Expression of the GFP-tagged protein in developing zygotes/ookinetes. |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation In this study 5 (translationally repressed) genes were C-terminally tagged with GFP (PBANKA_082120, PBANKA_133470, PBANKA_111410, PBANKA_010770, PBANKA_072090. All genes are transcribed in gametocytes but expression of the GFP-tagged proteins only occurs after fertilization in the developing zygote/ookinete Other mutants |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0107700 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0609100 | ||||||||||||||||||||||||||
Gene product | zinc transporter ZIP1, putative | ||||||||||||||||||||||||||
Gene product: Alternative name | |||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | GFP | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence |
ATTTCGATATCGGGGAATTCCAATTATTTTCATTGTCTTCATTGATATTATCATGTTTAT
| ||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | In situ C-terminal GFP-tagging was performed by single crossover homologous recombination into the corresponding locus using construct pLIS0097. The construct contain the tgdhfr/ts selectable marker under the control of P. berghei dhfr/ts 5′ and 3′ UTRs. Primers used to amplify the targeting regions corresponding to the 3′ end of the ORF excluding the stop codon are listed in Additional file 6: Table S4. Targeting regions were cloned upstream and in frame with the GFP. The plasmid was linearized and transfected into line cl15cy1. | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |