Mutant/mutation
The mutant contains a C-terminal GFP-tagged version of an ETRAMP protein (PY03652; PY17X_0946500).
This locus has been tagged by  the CRISPR/Cas9 genome editing system through  introduction of a double strand break (by Cas9 and a targeting single guide RNA; sgRNA), followed by repair through homologous recombination (see 'Additional information')

Protein (function)
Early transcribed membrane protein (ETRAMP) family member. Plasmodium conserved family with greater than ten members in P. falciparum. ETRAMPs are abundantly expressed early in the intraerythrocytic cycle and are small (frequently less than 200 aa) integral membrane proteins that are localized within the parasitophorous vacuolar membrane (PVM). All members have signal peptides plus a transmembrane domain. The ETRAMP/SEP proteins of P. yoelii and P. berghei (8-11 genes) show homology to members of the ETRAMP family of proteins of P. falciparum (14 genes) but the orthologous relationship of the different members is not completely resolved.
See also mutants  RMgm-643 (a knock-out of PY17X_0946500) and RMgm-641 (tagging of PY17X_0946500).


Phenotype
The phenotype has not been analysed in detail. This mutant has been generated to demostrate gene tagging by the CRISPR/Cas9 genome editing system (see 'Additional information')

See also mutants  RMgm-643 (a knock-out of PY17X_0946500) and RMgm-641 (tagging of PY17X_0946500).

Additional information

The CRISPR/Cas9 genome editing system has been used to tag PY17X_0946500 with GFP.

The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats and Cas9 endonuclease-mediated genome editing) system The CRISPR/Cas9 system was originated from a prokaryotic RNA programmable nuclease that can introduce a double-strand break (DSB) at a specific site on a chromosome through heterologous expression of two components: Cas9 nuclease and a targeting single guide RNA (sgRNA).
Target-specific DSBs introduced by the CRISPR/Cas9 system can be repaired by homologous recombination if a donor template is provided. The CRISPR/Cas9 system has been shown to be highly efficient in other organisms for generating gene knock-in (KI), KO, or allelic replacements.

CRISPR/Cas9-mediated genome editing requires expression of two components: Cas9 nuclease and a targeting single guide RNA (sgRNA), which form a complex to induce a double-strand break (DSB) at the targeted site.

To reduce the size of the plasmid construct and to overcome the problem of limited selectable markers available for P. yoelii,  an expression plasmid was constructed that contains the human dihydrofolate reductase (hdhfr)-2A peptide-gfp genes under the P. berghei eef1a (Pbeef1a) promoter and showed bicistronic expression of both genes after introduction into the P. yoelii 17XNL strain.
The viral “ribosome skip” 2A peptide has been shown to coordinate coexpression of two individual genes under a single promoter in P. falciparum

Because Cas9 is a nuclease functioning within the nucleus, two nuclear localization signals (NLSs) were attached to the 5' and 3' of the Cas9 gene to direct the protein to the nucleus.

In mammalian systems, sgRNA is synthesized by RNA polymerase III, and transcription is driven by a U6 small nuclear RNA (snRNA) promoter. By searching the P. yoelii genome database,  a U6 snRNA homolog was identified and  a 350-base-pair (bp) segment upstream of the transcriptional start site of U6 snRNA was cloned to function as a promoter.

A Cas9-sgRNA plasmid was constructed containing both the hdhfr-2A-SpCas9 and PyU6-sgRNA cassettes with cloning sites for the insertion of donor template sequences (for homologous recombination at target sequences in the genome).

Next a construct (pYC-Py03652-gfp) was generated containing a 710-bp C-terminal region of the Py03652 gene (PY17X_0946500) followed by the gfp gene and a 779-bp 3' untranslated region (3' UTR) of the Py03652 gene. To prevent binding and cleavage of the integrated DNA by the Cas9/sgRNA complex, we introduced five silent nucleotide substitutions at the sgRNA target site in the donor template. See Figure below. One sgRNA was designed to target the site close to the C-terminal part of the coding region.

FIG.: CRISPR/Cas9-mediated tagging of the endogenous PY17X_0946500 (Py03652) gene with the gfp gene. Schematic construct for tagging PY17X_0946500 with gfp. The plasmid contains the Cas9 and sgRNA expression cassettes and donor template for HR repair after double-strand break (DSB) targeting the PY17X_0946500 C-terminal part of the coding sequence (CDS) (red thunderbolt). The directions and positions of primers p53 to p60 are indicated by the small black arrows.

One day after electroporation of the plasmids into the P. yoelii 17XNL strain, parasites were selected with pyrimethamine (Pyr) supplied in drinking water. Pyr-resistant parasites with integration of donor template into the 3' end of PY17X_0946500 were obtained 5 days after electroporation.

sgRNA's :
GTCTTTATGTGGGTAACTTAAGG (genomic target sequence); GTCTTTATGTGGGTAACTTA (sgRNA target sequence)

See below for primer sequences used to amplify the targeting regions of PY17X_0946500

Other mutants
See RMgm-1095 for gene-deletion (knock-out) mutants that have been generated by this CRISPR/Cas9 system
See RMgm-1097 for introducing specific mutations in target genes using the CRISPR/Cas9 system