Summary

RMgm-1095
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_0305700; Gene model (P.falciparum): Not available; Gene product: serine repeat antigen 1 (SERA1)
PhenotypeNo phenotype has been described
Last modified: 27 July 2014, 13:52
  *RMgm-1095
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24987097
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherZhang, C; Yuan, J
Name Group/DepartmentState Key Laboratory of Cellular Stress Biology, Innovation Center for Cell Biology, School of Life
Name InstituteXiamen University
CityXiamen, Fujian
CountryChina
Name of the mutant parasite
RMgm numberRMgm-1095
Principal nameΔsera1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant contains a disrupted sera1 locus.
This locus has been disrupted by  the CRISPR/Cas9 genome editing system through  introduction of a double strand break (by Cas9 and a targeting single guide RNA; sgRNA), followed by repair through homologous recombination (see 'Additional information')

Protein (function)
Plasmodium species possesses SERAs of two major groups, specified as 'cysteine-type SERAs' and 'serine-type SERAs'. The genomes of different Plasmodium species contain different numbers of SERA genes. P. falciparum possesses nine SERA protease genes whereas the P. berghei and P. yoelii genome contains five. P. falciparum possesses six “serine-type” (SERA1 to SERA5 and SERA9) and three “cysteine-type” (SERA6 to SERA8) SERAs. In P. falciparum mutants have been generated lacking expression of SERA1, 2, 3, 4 , 7, 8 and 9 without a distinct phenotype in the blood stages (MvCoubrie J.E. et al,  2007, Infection and Immunity, 75:5565-74). SERA genes of P. berghei and P. yoelii are arranged in a tandem cluster that contains two serine-type SERAs (PbSERA1, -2) and three cysteine-type SERAs (PbSERA3, -4 and -5). See also mutants RMgm-862 (knock-out of P. yoelii sera1), RMgm-864 (tagging of of P. yoelii sera1).

Phenotype
The phenotype has not been analysed in detail. This mutant has been generated to demostrate gene deletion by the CRISPR/Cas9 genome editing system (see 'Additional information')

See also mutants RMgm-862 (knock-out of P. yoelii sera1), RMgm-864 (tagging of of P. yoelii sera1).

Additional information

The CRISPR/Cas9 genome editing system has been used to delete sera1.

The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats and Cas9 endonuclease-mediated genome editing) system The CRISPR/Cas9 system was originated from a prokaryotic RNA programmable nuclease that can introduce a double-strand break (DSB) at a specific site on a chromosome through heterologous expression of two components: Cas9 nuclease and a targeting single guide RNA (sgRNA).
Target-specific DSBs introduced by the CRISPR/Cas9 system can be repaired by homologous recombination if a donor template is provided. The CRISPR/Cas9 system has been shown to be highly efficient in other organisms for generating gene knock-in (KI), KO, or allelic replacements.

CRISPR/Cas9-mediated genome editing requires expression of two components: Cas9 nuclease and a targeting single guide RNA (sgRNA), which form a complex to induce a double-strand break (DSB) at the targeted site.

To reduce the size of the plasmid construct and to overcome the problem of limited selectable markers available for P. yoelii,  an expression plasmid was constructed that contains the human dihydrofolate reductase (hdhfr)-2A peptide-gfp genes under the P. berghei eef1a (Pbeef1a) promoter and showed bicistronic expression of both genes after introduction into the P. yoelii 17XNL strain.
The viral “ribosome skip” 2A peptide has been shown to coordinate coexpression of two individual genes under a single promoter in P. falciparum

Because Cas9 is a nuclease functioning within the nucleus, two nuclear localization signals (NLSs) were attached to the 5' and 3' of the Cas9 gene to direct the protein to the nucleus.

In mammalian systems, sgRNA is synthesized by RNA polymerase III, and transcription is driven by a U6 small nuclear RNA (snRNA) promoter. By searching the P. yoelii genome database,  a U6 snRNA homolog was identified and  a 350-base-pair (bp) segment upstream of the transcriptional start site of U6 snRNA was cloned to function as a promoter.

A Cas9-sgRNA plasmid was constructed containing both the hdhfr-2A-SpCas9 and PyU6-sgRNA cassettes with cloning sites for the insertion of donor template sequences (for homologous recombination at target sequences in the genome).

Next the plasmid pYC-Pysera1 was constructed containing a 46-bp tag DNA (for PCR primers) flanked by two homologous regions of Pysera1 (0.7 kb of the 5'-flanking region and 0.8 kb of the 3'-flanking region). see Figure below



FIG.: CRISPR/Cas9-mediated deletion of P. yoelii sera1 gene. Schematic construct for disrupting the Pysera1 gene. The plasmid contains Cas9 and sgRNA expression cassettes and donor template for HR repair after a double-strand break (DSB) at the 3' end of the Pysera1 exon 2 (red thunderbolt). The DNA inserted (In) between the left and right arms was added to detect donor integration in the design of the PCR primers. Exons 1 to 4 are indicated by the yellow boxes. TS (blue box) indicates the sgRNA target sequence. The positions and directions of primers p10 to p21 are indicated by the small black arrows.

Considering potential variation in target site accessibility by the Cas9/sgRNA complex,  two sgRNAs were designed to target the 3'end of the Pysera1 exon 2, generating plasmids pYC-sera1-sgRNA1 and pYC-sera1-sgRNA2 (see below).

One day after electroporation of the plasmids into the P. yoelii 17XNL strain, parasites were selected with pyrimethamine (Pyr) supplied in drinking water. Pyr-resistant parasites were observed microscopically 5 to 7 days after electroporation. PCR analysis of genomic DNA from parental strain 17XNL and plasmid-transfected parasites indicated successful integration of left and right homologous arms at specific sites directed by sgRNA1 and sgRNA2, respectively.

To  confirm the general usage of the CRISPR/Cas9 system for gene deletion, the paper describes the sucessful deletion of another two genes (which are not essential for blood stage development): Pysera2 (PY17X_0305600), which encodes another Plasmodium serine protease, and PyPDH/E1a (PY17X_0925800).

Two sgRNA's have been tested :
sgRNA 1: GTACCGGGAAACTCTGATCAAGG (genomic target sequence); GTACCGGGAAACTCTGATCA (sgRNA targetr sequence)
sgRNA 2: GCTAGCGACTGTTTCTTACATGG (genomic target sequence); GCTAGCGACTGTTTCTTACA (sgRNA targetr sequence)

See below for primer sequences used to amplify the targeting regions of sera1

Other mutants
See RMgm-1096 for gene-tagging mutants that have been generated by this CRISPR/Cas9 system
See RMgm-1097 for introducing specific mutations in target genes using the
CRISPR/Cas9 system


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_0305700
Gene Model P. falciparum ortholog Not available
Gene productserine repeat antigen 1
Gene product: Alternative nameSERA1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedCRISPR/Cas9 construct: integration through double strand break repair
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo reduce the size of the plasmid construct and to overcome the problem of limited selectable markers available for P. yoelii, an expression plasmid was constructed that contains the human dihydrofolate reductase (hdhfr)-2A peptide-gfp genes under the P. berghei eef1a (Pbeef1a) promoter and showed bicistronic expression of both genes after introduction into the P. yoelii 17XNL strain.
The viral “ribosome skip” 2A peptide has been shown to coordinate coexpression of two individual genes under a single promoter in P. falciparum

Because Cas9 is a nuclease functioning within the nucleus, two nuclear localization signals (NLSs) were attached to the 5' and 3' of the Cas9 gene to direct the protein to the nucleus.

In mammalian systems, sgRNA is synthesized by RNA polymerase III, and transcription is driven by a U6 small nuclear RNA (snRNA) promoter. By searching the P. yoelii genome database, a U6 snRNA homolog was identified and a 350-base-pair (bp) segment upstream of the transcriptional start site of U6 snRNA was cloned to function as a promoter.

A Cas9-sgRNA plasmid was constructed containing both the hdhfr-2A-SpCas9 and PyU6-sgRNA cassettes with cloning sites for the insertion of donor template sequences (for homologous recombination at target sequences in the genome).

Next the plasmid pYC-Pysera1 was constructed containing a 46-bp tag DNA (for PCR primers) flanked by two homologous regions of Pysera1 (0.7 kb of the 5'-flanking region and 0.8 kb of the 3'-flanking region)

Considering potential variation in target site accessibility by the Cas9/sgRNA complex, two sgRNAs were designed to target the 3'end of the Pysera1 exon 2, generating plasmids pYC-sera1-sgRNA1 and pYC-sera1-sgRNA2.

The plasmid containing sgRNA and Cas9 (and 3'/5'-sera homology regions) contains a hdhfr selection cassette. This cassette is not integrated into the genome.
Sequence of the sgRNA:
sgRNA 1: GTACCGGGAAACTCTGATCAAGG (genomic target sequence); GTACCGGGAAACTCTGATCA (sgRNA targetr sequence)
sgRNA 2: GCTAGCGACTGTTTCTTACATGG (genomic target sequence); GCTAGCGACTGTTTCTTACA (sgRNA targetr sequence)
See below for primer sequences used to amplify the targeting regions of sera1
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TACACCTTTTAACATGACCTAAT
Additional information primer 1p10 (5'integration; 842bp)
Sequence Primer 2CGATTAGCGTCCGCGGGGACCAT
Additional information primer 2p12 (5'integration; 842bp)
Sequence Primer 3ACGCTAATCGTAGCTAGCCTGCT
Additional information primer 3p13 (3'integration, 965bp)
Sequence Primer 4ACAACTTAAACCATAGTGCACTA
Additional information primer 4p14 (3'integration, 965bp)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6