RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-10
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1 (AMA1)
PhenotypeNo phenotype has been described
Last modified: 5 April 2009, 23:42
  *RMgm-10
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Not published (yet)
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherC.H.M. Kocken; A.M. Voorberg-v.d. Wel; C.J. Janse; A.W. Thomas
Name Group/DepartmentDepartment of Parasitology
Name InstituteBPRC
CityRijswijk
CountryThe Netherlands
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative nameAMA1
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe attempts to disrupt ama-1 (apical membrane antigen 1 precursor, putative; pb66) have not been published. Homologous replacement of the P. berghei ama-1 with its own gene was successful (A.M. Voorberg-v.d. Well, unpublished observations). Attempts to dirupt the homolog of P. falciparum (PF11_0344) also failed (Triglia et al., (2000), Mol. Microbiol. 38: 706-18).
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATTCCCATGGAACCAAAATAAC
Additional information primer 1fwd pb13 (1,5kb)
Sequence Primer 2TTTTATATCGTTTTATTTTATTAATATTTTTAATTTAC
Additional information primer 2rev pb8 (1,5kb)
Sequence Primer 3GTAAAATATTAACTAGCC
Additional information primer 3fwd Pb15 (0.6kb)
Sequence Primer 4ATGATAATAAAACATCAC
Additional information primer 4rev Pb16 (o.6kb)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren